1 / 15

Section: The Structure of DNA

Section: The Structure of DNA. Read each question, and answer based upon what you learn in the section. 1. With what kinds of bacteria did Griffith inject mice? 2. What was different about the S bacteria and the R bacteria? 3. Why were the heat-killed S bacteria harmless?

ashton-wong
Download Presentation

Section: The Structure of DNA

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Section: The Structure of DNA Read each question, and answer based upon what you learn in the section. 1. With what kinds of bacteria did Griffith inject mice? 2. What was different about the S bacteria and the R bacteria? 3. Why were the heat-killed S bacteria harmless? 4. Why was the mixture of heat-killed S bacteria and R bacteria virulent? 5. What did Griffith discover as a result of his experiments? 6. How did Avery discover that the material responsible for transformation in bacteria was DNA? 7. Viruses that infect bacteria are called [bacteriophages / rough]. 8. A virus is made of DNA and [proteins / cell walls]. 9. Radioactive sulfur was used to label the [DNA / protein] in the viruses. 10. Radioactive phosphorus was used to label the [DNA / protein] in the viruses. 11. Hershey and Chase discovered that after the 32P-labeled phages infected the bacteria, most of the radioactive phosphorus was found in the layer containing [bacteria / phage]. Match the letter of the phrase with the appropriate term _____ 12. double helix _____ 13. nucleotides _____ 14. deoxyribose _____ 15. hydrogen bond _____ 16. nitrogenous bases _____ 17. adenine _____ 18. cytosine _____ 19. Chargaff Explain how the terms in each pair are related to each other. 20. base-pairing rules, complementary 21.Wilkins and Franklin, DNA structure a. a five-carbon sugar b. type of weak bond between base pairs that holds the double helix together c. four kinds and they form specific pairs d. subunits that make up DNA e. one of two pyrimidines used as a nitrogenous base in nucleotides f. one of two purines used as a nitrogenous base in nucleotides g. discovered that the amount of adenine always equaled the amount of cytosine and that guanine always equaled cytosine h. two strands of nucleotides twisted around each other

  2. Concept Check.Using the rules of complementary bases and h-bonding, determine what each shape is. Box in and label each nucleotide. Box in and label the backbone. To solve: Look at the number of rings then the number of bonds… A has ________ rings and has ______ bonds with _____. G has ________ rings and has ______ bonds with _____.

  3. Construct a DNA model Using Base-pairing Rules. Homework: 25 Pts. Due tomorrow to gain access to DNA Extraction Lab. Template Strand 2 rings 3 bonds 1 ring • Directions: • Answer Review Questions on back: • What is the basic subunit for DNA? • What are the three parts? • Which parts are the backbone? • Which nucleotides are purines? • Which nucleotides are pyrimidines? • How do you tell the difference between the two? • What type of bond holds together DNA strands? • Cut out the nucleotides from the Nucleotide Bank (right). • Match them up with the template strand above based upon base-pairing rules then tape/glue beneath. • Determine the sequence (order of the string of nucleotides read left to right) for both the template strand and the new complimentary strand. Label the sequence of the template and complimentary strand on the lines with the nucleotide abbreviation. Template Strand: G __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ Complementary Strand:___ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ Nucleotide Bank

  4. 1.________________________ 20. 2.__________________________ 3.___________________________ 4.___________________________ 5.___________________________ 6.__________________________ 7.__________________________ 8._______________ _________ 9.__________________________ 10.________________________ 11._________________ _________________ _________________ 12._________________ _________________ 13._____________ _____________ _____________ _____________ 14._________________ _________________ 15._____________ _____________ _____________ _____________ 16.________________________ 17.____ ____ ____ ____ 18. There are _____ between ___ & ___; ___ between ___ & ___. 19. ________________________

  5. Replication. a. add nucleotides to the exposed bases according to the base-pairing rules b. process of making a copy of DNA c. two Y-shaped areas that form when the double helix separates in DNA replication d. opens up the double helix by breaking the hydrogen bonds between nitrogen bases e. each double-stranded DNA helix is made up of one of these after DNA replication Write the term and the matching description. • DNA replication • DNA helicase • replication forks • DNA polymerases • new DNA strand Answer the following questions. • What is DNA replication? • When does DNA replication occur? • What must occur before DNA replication can begin? • What are the three main stages of replication and what happens at each stage? • Identify the two major enzymes used during DNA replication and describe their function. a. b. • What prevents the separated DNA strands from reattaching to one another during DNA replication? • What prevents the wrong nucleotide from being added to the new strand during DNA replication? • Prokaryotic DNA is reproduced with ________ replication forks. • Human replication occurs with ________ replication forks. • Each human chromosome is replicated in about ___ hours and in about _______ sections. • The number of nucleotides between each replication fork in human DNA is approximately ____.

  6. 13.2 In-class Activity: Replication Comparison • Label the letters on a ½ sheet of paper. • Save this paper for a follow-up activity that will be turned in at the end of class. • Word-bank: Original DNA (x2), New DNA (x2), Replication Forks (x2), Replication bubble • You have 10 minutes! A C E B G F D

  7. DNA Replication Drawing Scoring Rubric • You are responsible for understanding the process of replication and being able to identify the 3 steps as well as identifying all the key components involved. • Your assignment is to draw all 3 steps in the process of replication in one drawing (template provided). • You must show each stage of replication in the illustration, labeling all the steps, proteins, landmarks, and & showing what DNA is where according to the rubric. • This is worth 25 points. Replication Enzymes DNA Polymerase Helicase Ligase

  8. DNA Replication Drawing A T A G T A C C T A C A G C T C G G A T C A C A T C T G C G A

  9. Quick Lab (10pts): DNA Replication Rate Cancer is a disease caused by cells that divide uncontrollably. Faster replication means faster spread of the disease. Scientists studying drugs that treat cancer often measure the effectiveness of a drug by its effect on DNA replication. During normal DNA replication, nucleotides are added at a rate of about 50 nucleotides per second in mammals and 500 nucleotides per second in bacteria. • (2pts) Calculate the time it would take a bacterium to add 4000 nucleotides to one DNA strand undergoing replication. • (2pts) Calculate the time it would take a mammalian cell to add 4000 nucleotides to one DNA strand undergoing replication. • (3pts) Critical Thinking. Predict Outcomes: How would the total time needed to add the 4000 nucleotides be affected if a drug that inhibits (prevents) DNA polymerases was present? • (3pts) Critical Thinking. Predict Outcomes: How do you think this is this an effective treatment of cancer?

  10. Gene Expression. Transcription and Translation a. the entire process by which genes are used to build proteins/traits. b. a molecule made of linked nucleotides c. the process of reading instructions on an RNA molecule to put together the amino acids that make up a protein d. the process of transferring a gene’s instructions for making a protein to an RNA molecule e. a nitrogenous base used in RNA instead of the base thymine found in DNA In the space provided, write the letter of the description that best matches the term or phrase. 1. ribonucleic acid (RNA) 2. uracil 3. transcription 4. translation 5. gene expression Complete each statement by identifying the correct term or phrase in the brackets. 6. Transcription begins when [RNA / RNA polymerase] binds to the gene’s promoter. 7. RNA polymerase adds complementary [DNA / RNA] nucleotides as it “reads” the gene. 8. In eukaryotes, transcription takes place in the [nucleus / cytoplasm]. Read each question, and write your answer in the space provided. 9.What are two differences between transcription and DNA replication? 10.What determines where on the DNA molecule transcription begins and where it ends? Compare the two terms in a sentence. 11. RNA, messenger RNA 12. codons, genetic code Study the following six steps in the synthesis of proteins. Determine the order in which the steps take place. Write the number of each step in order. 13. The codon following the start codon then receives the tRNA molecule with the complementary anticodon. The tRNA carries the amino acid specified by the codon. 14. Steps 2–5 are repeated until a stop codon is reached. The newly made protein is released into the cell. 15. The first tRNA detaches, leaves behind its amino acid, and moves away from the ribosome. 16. Enzymes help form a peptide bond between the amino acids of adjacent tRNA molecules. 17. The tRNA (with its growing protein chain) and mRNA move one codon down, and the next codon is ready to receive the next tRNA and its amino acid. 18. An mRNA, the ribosome, and a tRNA carrying the amino acid methionine bind together. The tRNA bonds to the “start” codon AUG.

  11. Transcription/ Translation In-class Exercise • Transcribe the gene! • As you’ve learned, DNA contains the instructions for making proteins in the form of genes. mRNA is made by RNA polymerase as the compliment to the gene region in the process of transcription. Your exercise today is to transcribe a gene from the sequence below and answer the following questions. Pay attention to the start and stop signals! Gene Xlr23: CGAACCTACAGTTCCGCGTCGGGCTAGACTGGCAATG • What is the first step in transcription? • How does the RNA polymerase know where to start? • Identify the “start” sequence within the sequence (underline it). • What is the second step of transcription? • What RNA nucleotide complements adenine? • What is the third step of transcription? • How does RNA polymerase know where to end? • Identify the “stop” sequence (underline it). • What is the sequence of the mRNA for the gene Xlr23?

  12. TRX/TRL: CW/HW: Using the Genetic Code HWGenetic Code of Keratin Keratin is one of the proteins in hair. The gene for keratin is transcribed and translated by certain skin cells just underneath the growing hair. The sequence below is part of the mRNA molecule that is transcribed from the gene for keratin. Analysis 1. Determine the sequence of amino acids that will result from the translation of the segment of mRNA above. Use the genetic code in Figure 13. _____________________________________________________________________________ _____________________________________________________________________________ 2. Determine the anticodon of each tRNA molecule that will bind to this mRNA segment. ______________________________________________________________________________________________________________________________________________________________ 3. Critical Thinking Recognizing Patterns: Determine the sequence of nucleotides in the segment of template DNA from which this mRNA strand was transcribed. ______________________________________________________________________________________________________________________________________________________________ 4. Critical Thinking Recognizing Patterns: Determine the sequence of nucleotides in the segment of DNA that is complementary to the DNA segment that is described in item 3. ______________________________________________________________________________________________________________________________________________________________

  13. TRX/TRL: CW/HW: Using the Genetic Code HWGenetic Code of Keratin Keratin is one of the proteins in hair. The gene for keratin is transcribed and translated by certain skin cells just underneath the growing hair. The sequence below is part of the mRNA molecule that is transcribed from the gene for keratin. Analysis 1. Determine the sequence of amino acids that will result from the translation of the segment of mRNA above. Use the genetic code in Figure 13. _____Methionine – Serine – Arginine – Glutamic Acid – Phenylalanine – Serine - __________ 2. Determine the anticodon of each tRNA molecule that will bind to this mRNA segment. _____UAC – AGA – GCA – CUU – AAA – AGG ______________________________________________________________________ 3. Critical Thinking Recognizing Patterns: Determine the sequence of nucleotides in the segment of template DNA from which this mRNA strand was transcribed. ____TAC – AGA – GCA – CTT – AAA – AGG ______________________________________________________________________________ 4. Critical Thinking Recognizing Patterns: Determine the sequence of nucleotides in the segment of DNA that is complementary to the DNA segment that is described in item 3. ____ATG – TCT – CGT – GAA – TTT – TCC ______________________________________________________________________________

  14. In Class Exercise • Complete the Gene. • Translation is the last step of gene expression as it forms the final polypeptide. Your exercise today is to take the Xlr23 gene we transcribed in the transcription exercise and translate it into a polypeptide. Write your polypeptide as a series of circles with the name of the corresponding amino acid within. The circles represent the individual amino acids. You translate the rest A = B = C =

  15. Mutations Explain how the terms in each pair differ in meaning. 1. mutation, mutagen 2. point mutation, silent mutation 3. reading frame, frameshift mutation Complete each statement by underlining the correct term in the brackets. 4. If a mutation causes a sequence of nucleotides to change from ACGAGA to ACGAGGA, the mutation is called a(n) [insertion / deletion] mutation. 5. Mutations that change one or just a few nucleotides in a gene on a chromosome are called [random / point] mutations. 6. If a point mutation is such that it causes a codon to specify a different amino acid, the mutation is called a [missense / silent] mutation. 7. If a mutation causes a sequence of nucleotides to change from ACGAGA to ACGGA, the mutation is called a(n) [insertion / deletion] mutation. 8. A chromosomal mutation that leads to repetitive alleles is called a(n) [inversion / duplication]. Complete each statement by writing the correct term in the space provided. 9. Mutations can only be passed on to offspring if they occur in cells called ______________ cells. 10. Mutations that cause a cell to divide uncontrollably can lead to growth of a _______________. 11. When chromosome pairs fail to separate properly during meiosis, the error is called _________. 12. The condition of having two or more sets of chromosomes is called __________________. From the list on the far right, determine the word that would best fit into the blank that would determine the cause or affect for the situation.

More Related