1 / 14

Ye Yan

Different Tumorigenesis Of The Orthotopic And Hypodermic Models Of Papillary Thyroid Carcinoma Cells In Nude Mice. Ye Yan Metabolic Diseases Hospital & Tianjin Institute of Endocrinology, Tianjin Medical University, Tianjin, China. BACKGROUND.

ava-contreras
Download Presentation

Ye Yan

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Different Tumorigenesis Of The Orthotopic And Hypodermic Models Of Papillary Thyroid Carcinoma Cells In Nude Mice. Ye Yan Metabolic Diseases Hospital & Tianjin Institute of Endocrinology, Tianjin Medical University, Tianjin, China

  2. BACKGROUND Papillary thyroid carcinoma (PTC) is the most prevalent form accounting for 80% of all thyroid carcinoma. PTC is frequently associated with RET/PTC1 rearrangement and BRAFV600E(T1799A) mutation, especially in the sporadic patients.

  3. OBJECTIVE To observe and compare the different tumorigenesis of the orthotopic and hypodermic models of PTC cell lines in nude mice.

  4. METHODS The following human PTC cell lines were used: TPC-1, B5-16 and B2-7. TPC-1 and B2-7---- RET/PTC1 rearrangement B5-16 ----BRAFV600E mutation

  5. The Orthotopic and hypodermic nude mice models of thyroid cancer. Experimental animal: 8-week-old female nude mice. Anesthesia: intraperitoneal injection of chloralic hydras. Surgery: A 1-cm-long midline incision was made, then the underlying submandibular glands and the strap muscles were bluntly dissected. The thyroid was clearly exposed. Orthotopic and hypodermic injection: 2*105 cells in D-Hanks was injected into the left thyroid gland and under back skin of nude mice, respectively. • Observation time: At 4 and 12 weeks. • Observation data: The weight of orthotopic thyroid tumor and hypodermic tumor. Serum FT3,FT4 were detected using chemiluminescent immunoassay.

  6. RESULTS Marker TPC-1 B2-7 B5-16 B5-16:BRAFV600E(T1799A mutation) GGTGATTTTGGTCTAGCTACAGAGAAATCTCGATGGAGTGGGTCCCATCAGTTTGAACAG TPC-1: GGTGATTTTGGTCTAGCTACAGTGAAATCTCGATGGAGTGGGTCCCATCAGTTTGAACAG B2-7: GGTGATTTTGGTCTAGCTACAGTGAAATCTCGATGGAGTGGGTCCCATCAGTTTGAACAG Marker TPC-1 B2-7 B5-16 GAPDH RET/PTC1

  7. The tumorigenesis of the orthotopic and hypodermic models of PTC cell lines in nude mice was remarkable dissimilarity. • TPC-1 and B5-16 were 100% tumorigenic in the orthotopic and hypodermic mice models (n=10). • However, B2-7 was only 10% tumorigenic in the orthotopic model, and it was negative in the hypodermic model (n=10).

  8. The development of the orthotopic and hypodermic tumor in TPC-1 and B5-16 models for 4 weeks. mg TPC-1 B5-16

  9. The development of the orthotopic and hypodermic tumor in TPC-1 and B5-16 models for 12 weeks. mg TPC-1 B5-16

  10. The level of thyroid hormone reflects the destroy of thyroid function in the orthotopic models. ** * * 4 weeks 12 weeks

  11. The morphological changes of the orthotopic thyroid tumor (HE staining) TPC-1 B5-16 Control

  12. CONCLUSION The growth of PTC cell lines needs different internal environment. The tumorigenesis of the orthotopic and hypodermic models of three PTC cell lines in nude mice was different. The hypodermic or orthotopic PTC models should be chosen according to the study objective. The hypodermic model---Its operation and observation is easy and convenient. The orthotopic model ---Its phenotype is close to the primary PTC.

  13. ACKNOWLEDGE Professor LS.Teng and Dr WB.Wang, The First Affiliated Hospital, College of Medicine, Zhejiang University. My teacher professor ZP.Chen ,YQ.Yan and my workmate. Metabolic Diseases Hospital & Tianjin Institute of Endocrinology, Tianjin Medical University, Tianjin, China

  14. THANK YOU

More Related