1 / 24

synthetic nucleases: implications in hpv e6 gene editing

synthetic nucleases: implications in hpv e6 gene editing. FEB 2013- FEB 2014. PRELIMINARY WORK. 1 2 3 4. Lane 1: SiHa Lane 2: CasKi Lane 3: c33a Lane 4 : ladder. A). SiHa. SiHa. CasKi. E6 PCR. B). C). E6 sequence of SiHa and CasKi Cell line.

badrani
Download Presentation

synthetic nucleases: implications in hpv e6 gene editing

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. synthetic nucleases: implications in hpv e6 gene editing FEB 2013- FEB 2014

  2. PRELIMINARY WORK

  3. 1 2 3 4 Lane 1: SiHa Lane 2: CasKi Lane 3: c33a Lane 4 : ladder A) SiHa SiHa CasKi E6 PCR B) C) E6 sequence of SiHa and CasKi Cell line

  4. LUMINEX ASSAY FOR CONFIRMING HPV SUBTYPE IN SiHa AND CasKi SiHa and CasKi were found to be positive for HPV 16 and negative for all other 21 subtypes. Beta globin was used as an internal control and both were positive for it.

  5. ZFN DESIGN

  6. Targeting downstream of the start site has 2/3 chance of causing a frame-shift and therefore a likely null mutation. Even if an in-frame deletion happens it might still be mutagenic. TGCAAGCAACAGTTACTGCGACGTGAGGTATATGACTTTGCT

  7. ZFN PAIR SEQUENCE MEL-I ASSAY

  8. ZFN ACTIVITY

  9. Good Transfection Efficiency

  10. Lane 1: ladder Lane 2: CasKi supernatant Lane 3 SiHa supernatant Lane 4:CasKi pellet Lane 5:SiHa pellet Lane 6: ladder Nuclease resistance Assay 4 5 6 1 2 3 ZFN editing 4% <1%

  11. Fok I nuclease variants Wild type ELD:KKR heterodimer EL:KK heterodimer

  12. Changing EL:KK clone to ELD: KKR Sharkey variant EL:KK Fok I ZFN ELD: KKR ELD:KKR FokI pZFN 1 2 3 1 2 3

  13. DNA after treatment CasKi 2 3 4 5 1 Lane 1: Control GFP Lane 2: Trt with CAG ZFNs at 37̊C Lane 3: Trt with CAG ZFNs at 30̊C Lane 4: Trt with ELD:KKR ZFNs at 37̊C Lane 5: Trt with ELD: KKR ZFNs at 30 ̊C SiHa 1 2 3 4 5

  14. RNA after treatment 1 2 3 4 5 6 7 8 9 10 Lane 1: control GFP in SiHa Lane 2: Control GFP in Caski SIHA Lane 3: Trt with CAG ZFNs at 37 degrees Lane 4: Trt with CAG ZFNs at 30 degrees Lane 5: Trt with ELD:KKR ZFNs at 37 degrees Lane 6: Trt with ELD:KKR ZFNs at 30 degrees CASKI Lane 7: Trt with CAG ZFNs at 37 degrees Lane 8: Trt with CAG ZFNs at 30 degrees Lane 9: Trt with ELD:KKR ZFNs at 37 degrees Lane 10: Trt with ELD:KKR ZFNs at 30 degrees E6 GAPDH

  15. CasKi

  16. Pellet • Trt with ELD: KKR ZFNs • Trt with CAG ZFNs at 30 degrees • 4. Trt with ELD: KKR at 30 • Degrees • Supernatant • 3. Trt with ELD:KKR at 30 degrees • 5. Trt with ELD: KKR ZFNs • 6. Trt with CAG ZFNs at 30 degrees SiHa Pellet Supernatant 5 6 3 4 1 2

  17. None of them contribute to ZFN editing efficiency improvement. Even treatment with mg132 did not yield any results.

  18. ZFN IMMUNOFLUORESCENCE

  19. SiHa ZFN treated 53BP1 Control

  20. Caski E6 Control ZFN Treated SiHa E6

More Related