1 / 21

Characterization of atpD of the Fe-Reducing Thermophilic Bacterium Caloramator celere

Characterization of atpD of the Fe-Reducing Thermophilic Bacterium Caloramator celere. - Santosh Pudasaini Saint Peter’s College, Jersey City, NJ. Dr. Mack Ivey Center for Space and Planetary Sciences, University of Arkansas, Fayetteville, AR. Iron Reduction.

baird
Download Presentation

Characterization of atpD of the Fe-Reducing Thermophilic Bacterium Caloramator celere

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Characterization of atpD of the Fe-Reducing Thermophilic Bacterium Caloramator celere - Santosh Pudasaini Saint Peter’s College, Jersey City, NJ. Dr. Mack Ivey Center for Space and Planetary Sciences, University of Arkansas, Fayetteville, AR.

  2. Iron Reduction • Anaerobic, primitive mode of metabolism • Chemolithoautotrophic growth • Evolved very early, thrive under extreme conditions

  3. Scope… • Abundance of Iron and CO2 in Mars. • A potential metabolic pathway in Martian condition

  4. Bacterial Iron Reduction • ATP generated by ATP Synthase • ATP Synthase: - transmembrane multiprotein complex - sits on bacterial plasma membrane - utilizes proton gradient created by the ETC - Fe (III) as electron acceptor

  5. Our Project • Caloramator celere, a novel Fe (III) reducing thermophile • atpD, a β-sub unit gene in the atp operon on C. celere • The most highly conserved of the atp operon genes • Most likely to share sequence similarity with previously sequenced orthologs • Will serve as a probe for isolation of the entire atp operon

  6. Objectives • Prepare C. celere cultures • Design primers using MSA • Extract DNA from the cultures • Perform PCR to amplify, clone and sequence atpD

  7. Culture Preparation • C. celere cultures grown in an anaerobic media. • Electron acceptor: • 90mM amorphous Fe(III) oxide • 20mM 9,10-anthraquinone 2,6 disulfonic acid (AQDS medium)

  8. Reduction of Fe (III) Before reduction After reduction

  9. Reduction of AQDS Before reduction After reduction

  10. Multiple Sequence Alignment • 38 ‘bacterial and Bacillales atpDs’ – gene bank of NCBI • Multiple alignment - vector NTI® AlinX tool • Highly conserved regions- ideal for primer design

  11. Criteria for Primers • The oligonucleotides were, in average, about 20-25 base pairs. • The GC content was about 50-60 percent. • The thermodynamic Tm was about 55-60 oC. • There were no dimers or hairpin loops. • If present, choose ones with a positive or a fairly large dimer dG and loop dG.

  12. Oligonucleotide (DNA): Length: 20 5’-TTCGGTGGTGCCGGTGTAGG-3’ CONDITIONS: - Molecular Weight: 6298.1 - %GC: 65.0 - Thermodynamic Tm: 60.2 - Hairpin Loops: 1 total TTCGGTG ||| G GGATGTGGCCGT Stem Length = 3 Loop Length = 5 Loop dG = -2.3 kcal/mol Dimers: 3 total TTCGGTGGTGCCGGTGTAGG +++ ||| GGATGTGGCCGTGGTGGCTT Stem Length = 3 Dimer dG = -1.7 kcal/mol TTCGGTGGTGCCGGTGTAGG |||| GGATGTGGCCGTGGTGGCTT Stem Length = 4 Dimer dG = -4.7 kcal/mol TTCGGTGGTGCCGGTGTAGG ||| +++ GGATGTGGCCGTGGTGGCTT Stem Length = 3 Dimer dG = -1.7 kcal/mol atpD_476_F

  13. Primers Design • 6 Primers designed from MSA • atpD_476_F 5’-TTCGGTGGTGCCGGTGTAGG-3’ • atpD_542_F 5’-CACGGTGGTATTTCTGTATTCGC-3’ • atpD_935_F 5’-GCCGATGACTATACTGACCCAGC-3’ • atpD_957_R 5’-GCTGGGTCAGTATAGTCATCGGC-3’ • atpD_1272_R 5’-ACCGTAAATTGTTCCGCTACGTGG-3’ • atpD_1377_R 5’-CCAACTAAACGGAATGCATCTTC-3’

  14. DNA Extraction • DNA extracted from the cultures grown following the protocol - ‘Protocols in Molecular Biology’-fourth edition. • Extracted DNA stored in TE buffer overnight. • Agarose gel electrophoresis performed to check for DNA. Marker DNA Lanes ↓ ↓ ↓

  15. DNA Extraction • Agarose gel electrophoresis of DNA sample stored in isopropanol. • Gel ran after extracting DNA sample precipitated in isopropanol. Marker DNA Lanes ↓ ↓ ↓ ↓

  16. DNA Extraction • Agarose gel electrophoresis of DNA sample freshly extracted from culture. • Agarose gel electrophoresis of cells taken directly from culture. Marker DNA Lanes ↓ ↓ ↓

  17. Polymerase Chain Reaction (PCR)

  18. Polymerase Chain Reaction (PCR) • Primers designed from MSA, B. cohnii DNA • DNA sample extracted from C.celere culture

  19. Challenges for successful PCR • Insufficient cell density • Inefficient cell lysis • Rapid degradation of the DNA in extracts.

  20. Future Directions • Extract DNA samples from cultures, keep them from degradation. • Perform PCR with the Primers designed from MSA. • Clone the amplified DNA into a plasmid vector and perform sequencing.

  21. Acknowledgements • Center for Space and Planetary Sciences, University of Arkansas, Fayetteville, AR. • Dr. Mack Ivey • Jackie Denson • NASA Thank You

More Related