GENETIC MARKERS IN PLANT BREEDING

1. GENETIC MARKERS IN PLANT BREEDING

2. Marker Gene of known function and location, or a mutation within a gene that allows studying the inheritance of that gene Genetic information resides in the genome Genetic Marker Any phenotypic difference controlled by the genes, that can be used for studying recombination processes or selection of a more or less closely associated target gene

3. Genetic Marker • Morphological marker • Molecular marker Readily detectable sequence of protein or DNA that are closely linked to a gene locus and/or a morphological or other characters of a plant Readily detectable sequence of protein or DNA whose inheritance can be monitored and associated with the trait inheritance independently from the environment 1. Protein marker2. DNA marker

4. Molecular markers • Sequencing(SNPs) • Microsatellites (SSRs) • AFLP(Amplified Fragment Length Polymorphism) • RAPD(random amplified polymorphic DNA) Resolutionpower • chloroplastDNA PCR-RFLP • allozymes (protein-electrophoresis)

5. Morphological marker (phenotypic/naked eye marker) 2-rowed 6-rowed Black white hulled naked non-waxy waxy

6. Karl Von Linne (1707-1778)

7. Molecular markers • Important aspect: • Polymorphism • The existence of two or more forms that are genetically distinct from one another but contained within the same interbreeding population • Pattern of inheritance • The pattern of genetic information transmission from parents to progeny

8. Polymorphism

9. Gel configuration P 1 P 2 O 1 O 2 Gel configuration P 1 P 2 O 2 O 1 Co-dominant marker Polymorphism -Parent 1 : one band -Parent 2 : a smaller band -Offspring 1 : heterozygote = both bands -Offspring 2 : homozygote parent 1 Dominant marker Polymorphism Parent 1 : one band -Parent 2 : no band -Offspring 1 : homozygote parent 1 -Offspring 2 : ????

10. Dominant versus Co-dominant Dominant No distinction between homo- and heterozygotes possible No allele frequencies available RAPD Co-dominant Homozygotes can be distinguished from heterozygotes; Allele frequencies can be calculated microsatellites, SNP, RFLPs

11. Desirable properties for a good molecular marker • High Polymorphic • Co-dominant inheritance • Occurs throughout the genome • Reproducible • Easy, fast and cheap to detect • Selectivity neutral • High resolution with large number of samples • Nondestructive assay • Random distribution throughout the genome • Assay can be automated

12. Protein markers Genetic markers which based on protein polymorphisms a. Allozyme isoenzymes of proteins nature whose synthesis is usually controlled by codominant alleles and inherited by monogenic ratios. They show a specific banding pattern if separated by electrophoresis b. Isozyme A species of enzyme that exists in two or more structural form, which are easily identified by electrophoretic methods

13. Proteins Polymorphisms Seed storage proteins Isozymes

14. Isozyme

15. Isozyme Starch gel of the isozyme malate dehydrogenase (MDH). The numbers indicate first the MDH locus, and next the allele present (ie. 3-18 is locus 3 allele 18). Some bands are heterodimers (intralocus or interlocus).

16. DNA marker Segments of DNA with an identifiable physical location on a chromosome and whose inheritance can be followed A marker can be a gene, or it can be some section of DNA with no known function • Types of DNA Marker can be differentiated based on molecular technique used to develop the marker • Restriction enzymes • Hybridization • PCR • Sequencing

17. Stretch of nitrogen fixation gene in soybean 1 ccacgcgtcc gtgaggactt gcaagcgccg cggatggtgg gctctgtggc tgggaacatg 61 ctgctgcgag ccgcttggag gcgggcgtcg ttggcggcta cctccttggc cctgggaagg 121 tcctcggtgc ccacccgggg actgcgcctg cgcgtgtaga tcatggcccc cattcgcctg 181 ttcactcaga ggcagaggca gtgctgcgac ctctctacat ggacgtacag gccaccactc 241 ctctggatcc cagagtgctt gatgccatgc tcccatacct tgtcaactac tatgggaacc 301 ctcattctcg gactcatgca tatggctggg agagcgaggc agccatggaa cgtgctcgcc 361 agcaagtagc atctctgatt ggagctgatc ctcgggagat cattttcact agtggagcta 421 ctgagtccaa caacatagca attaaggtag gaggagggat ggggatgttg tgtggccgac 481 agttgtgagg ggttgtggga agatggaagc cagaagcaaa aaagagggaa cctgacacta 541 tttctggctt cttgggttta gcgattagtg cccctctctc atttgaactc aactacccat 601 gtctccctag ttctttctct gcctttaaaa aaaaatgtgt ggaggacagc tttgtggagt 661 ctgaaatcac catctacctt tacttaggtt ctgagtgcca aacccaaggc accaggcatg 721 cgtccttgac tccggagcca tcaggcaggc tttcctcagc cttttgcagc caagtctttt 781 agcctattgg tctgagttca gtgtggcagt tggttaggaa agaaggtggt tcttcgacca 841 ctaacagttt ggatttttta ggatgctagt cctttaaaa ………. DNA structure Chromosome to DNA

18. 1 ccacgcgtcc gtgaggactt gcaagcgccg cggatggtgg gctctgtggc tgggaacatg 61 ctgctgcgag ccgcttggag gcgggcgtcg ttggcggcta cctccttggc cctgggaagg 121 tcctcggtgc ccacccgggg actgcgcctg cgcgtgtaga tcatggcccc cattcgcctg 181 ttcactcaga ggcagaggca gtgctgcgac ctctctacat ggacgtacag gccaccactc 241 ctctggatcc cagagtgctt gatgccatgc tcccatacct tgtcaactac tatgggaacc 301 ctcattctcg gactcatgca tatggctggg agagcgaggc agccatggaa cgtgctcgcc 361 agcaagtagc atctctgatt ggagctgatc ctcgggagat cattttcact agtggagcta 421 ctgagtccaa caacatagca attaaggtag gaggagggat ggggatgttg tgtggccgac 481 agttgtgagg ggttgtggga agatggaagc cagaagcaaa aaagagggaa cctgacacta 541 tttctggctt cttgggttta gcgattagtg cccctctctc atttgaactc aactacccat 601 gtctccctag ttctttctct gcctttaaaa aaaaatgtgt ggaggacagc tttgtggag DNA M1 M2 Gene A Gene B MFG DNA marker MFG AAAGGGTTTAACCAAGGAATTCCATCGGGAATTCCG AACCTGAAAAGTTACCCTTTAAAGGCTTAAGGAA readily detectable sequence of DNA whose inheritance can be monitored and associated with the trait inheritance

19. Image from UV light table Image from computer screen

20. Basis for DNA marker technology • Restriction Endonucleases • DNA-DNA hybridization • Polymerase chain reaction (PCR) • DNA sequencing

21. RFLP techniques

22. 1 2 3 4 5 MFG 1 2 3 4 5 6 RFLP Polymorphisms interpretation 6

23. RFLP based markers • Examine differences in size of specific DNA restriction fragments • Require pure, high molecular weight DNA • Usually performed on total cellular genome Advantages and disadvantages of RFLP • Disadvantages • Time consuming • Expensive • Use of probes • Advantages • Reproducible • Co-dominant • Simple

24. AFLP Markers • Most complex of marker technologies • Involves cleavage of DNA with two different enzymes • Involves ligation of specific linker pairs to the digested DNA • Subsets of the DNA are then amplified by PCR • The PCR products are then separated on acrylamide gel • 128 linker combinations are readily available • Therefore 128 subsets can be amplified

28. AFLP Markers • Technically demanding • Reliable and stable • Moderate cost • Need to use different kits adapted to the size of the genome being analyzed. • Like RAPD markers need to be converted to quick and easy PCR based marker

29. RAPD • Amplifies anonymous stretches of DNA using arbitrary primers • Fast and easy method for detecting polymorphisms • Domimant markers • Reproducibility problems

30. Name Sequence OP A08 5’ –GTGACGTAGG- 3’ OP A15 5’ –TTCCGAACCC- 3’ OP A 17 5’ –GACCGCTTGT- 3’ OP A19 5’ –CAAACGTCGG- 3’ OP D02 5’ –GGACCCAACC- 3’ Sequences of 10-mer RAPD primers RAPD gel configuration RAPD Polymorphisms among landraces of sorghum M

31. RAPD Markers • There are other problems with RAPD markers associated with reliability • Because small changes in any variable can change the result, they are unstable as markers • RAPD markers need to be converted to stable PCR markers. • How?

32. RAPD Markers • The polymorphic RAPD marker band is isolated from the gel • It is used a template and re-PCRed • The new PCR product is cloned and sequenced • Once the sequence is determined, new longer and specific primers can be designed

33. VNTRVariable Number of Tandem Repeats • Tandem repeats (TR): DNA sequences which are existed in repeated numbers in the genome • Satellite DNA • Minisatellites • Microsatellites Variable Number (VN) High polymorphism in number of repeats

34. VNTRVariable Number of Tandem Repeats • Satellite DNA • 2-250 bp repeat unit size • Constitutes 1- 60% of the genome • Some can be separated in CsCl • ‘satellite band’ • Minisatellites • 9-50 bp repeat unit size • 100 – 1000 x repeated • Microsatellites • 2-6 bp repeat unit size • 10s – 100 x repeated

35. Microsatellites • Short tandem repeats (simple sequence repeat) • 2 – dinucleotides • 3 – trinucleotides • 4 – tetranucleotides • Randomly distributed in genome • Non-coding • Some within coding sequences • Especially trinucleotides • Some related to diseases • Nomenclature • Perfect GCTAGCCACACACACACACATGCATC • Interrupted GCTAGCCACACGTCACACACTGCATC • Compound GCTAGCCACACATATATGTGTGCATC

36. Repeat Sequence GCGCCGAGTTCTAGGGTTTCGGAATTTGAACCGTC ATTGGGCGTCGGTGAAGAAGTCGCTTCCGTCGTTTGATTCCGGTCGTCAGAATCAGAATCAGAATCGATATGGTGGCAGTGGTGGTGGTGGTGGTGGTTTTGGTGGTGGTGAATCTAAGGCGGATGGAGTGGATAATTGGGCGGTTGGTAAGAAACCTCTTCCTGTTAG ATTCTGGAATGGAACCAGATCGCTGGTCTAGAGGTTCTGCTGTGGAACCA….. GGT(5) SSR repeats and primers

37. P1 AATCCGGACTAGCTTCTTCTTCTTCTTCTTTAGCGAATTAGG AAGGTTATTTCTTCTTCTTCTTCTTCTTCTTCTTAGGCTAGGCG P2 P1 P2 SSR polymorphisms Gel configuration

38. SNPs on a DNA strand Hybridization using fluorescent dyes SNP (Single Nucleotide Polymorphisms) • Any two unrelated individuals differ by one base pair every 1,000 or so, referred to as SNPs. • Many SNPs have no effect on cell function and therefore can be used as molecular markers.

39. Genetic marker characteristics

40. Developing a Marker • Best marker is DNA sequence responsible for phenotype i.e. gene • If you know the gene responsible and has been isolated, compare sequence of wild-type and mutant DNA • Develop specific primers to gene that will distinguish the two forms

41. Developing a Marker • If gene is unknown, screen contrasting populations • Use populations rather than individuals • Need to “blend” genetic differences between individual other than trait of interest

42. Developing Markers • Cross individual differing in trait you wish to develop a marker • Collect progeny and self or polycross the progeny • Collect and select the F2 generation for the trait you are interested in • Select 5 - 10 individuals in the F2 showing each trait • Extract DNA from selected F2s • Pool equal amounts of DNA from each individual into two samples - one for each trait • Screen pooled or “bulked” DNA with what method of marker method you wish to use

43. MFG MFG Types of traits (types of markers) Multigenic trait; ex: plant growth =Quantitative Trait Loci Single gene trait: seed shape

44. USES OF MOLECULAR MARKER • Clonal identity • Parental analysis • Family structure • Population structure • Gene flow • Hybridisation • Phylogeny • Measure genetic diversity • Mapping • Tagging

45. Genetic Diversity • Define appropriate geographical scales for monitoring and management (epidemology) • Establish gene flow mechanism • identify the origin of individual (mutation detection) • Monitor the effect of management practices • manage small number of individual in ex situ collection • Establish of identity in cultivar and clones (fingerprint) • paternity analysis and forensic

46. Genetic Diversity

47. Mapping The determination of the position and relative distances of gene on chromosome by means of their linkage • Genetic map A linear arrangement of genes or genetic markers obtained based on recombination An ordering of genes and markers in a linear arrangement corresponding to their physical order along the chromosome, based on linkage. • Physical map A linear order of genes or DNA fragments An ordering of landmarks on DNA, regardless of inheritance, measured in base pairs.

48. Physical Mapping • It contains ordered overlapping cloned DNA fragment • The cloned DNA fragments are usually obtained using restriction enzyme digestion

49. QTL Mapping A set of procedures for detecting genes controlling quantitative traits (QTL) and estimating their genetics effects and location  To assist selection

50. Fundamental Genetics (Background for Linkage Analysis) • Rule of Segregation • offspring receive ONE allele (genetic material) from the pair of alleles possessed by BOTH parents • Rule of Independent Assortment • alleles of one gene can segregate independently of alleles of other genes • (Linkage Analysis relies on the violation of Independent Assortment Rule)