1 / 30

GENETICS

Explore Mendel's experiments on inheritance patterns, including incomplete dominance, codominance, and multiple alleles. Learn about linkage and sex chromosomes and their role in genetic variation. Discover the effects of mutations and environmental factors on gene expression.

beddie
Download Presentation

GENETICS

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. GENETICS Mendel’s expt. Incomplete Dorminant Codorminance Multiple allele Linkage and Sex Link Crossover Genetic Variation Mendel

  2. Some characteristics used in mendel’s experiment

  3. SSSsSsss Monohybrid(Law of Sgregation) ?

  4. Exercise of Pedigree

  5. Law of Independent Assortment Dihybrid RrYy x RrYy

  6. Backcross(self-pollination) TT x TT Tt x Tt T T T t T t TT TT Tt Tt tt T: tall pea t: short pea

  7. To test animals with dominant characteristics(LL or Ll) Test cross LL x l l Ll x l l L L l l L l l l Ll Ll Ll Ll Ll ll Ll ll

  8. Incomplete Dominance RR rr Rr

  9. Blood cells antigen Blood group Codominance AB O A B

  10. AB O A B A B i Multiple allele Phenotype Genotype A B Types of allele: i Dominant gene: Recessive gene:

  11. Person: 1 2 3 4 Ai i i Bi Ai Blood Group: Tonque roll : Tt Tt Tt tt

  12. B Blood transfusion White blood cell B A Antibody A Red blood cell with antigen A

  13. Ans: yellow flower red fruit : white flower yellow fruit 3 : 1 Y: yellow flower, y: white flower, R: red fruit, r: yellow fruit Linkage If: YyRr x YyRr According to Law of independent assortment, the ratio should be 9:3:3:1. Why? Allele of flower color and allele of fruit color are on the same chromosome.

  14. F1 generation Y Y y y Gamete R r R r F2 generation Genotype: Y Y Y Y y y y y r r R R R r R r Y Y y y Phenotype: Yellow flower Red fruit R r R r Ratio: 3 : 1

  15. Sex Chromosome

  16. SEX Linkage

  17. XBXb x XBY Male Gamete Female Gamete

  18. Haemophilia SAME AS COLOR BLINDNESS

  19. CROSS OVER

  20. Source of Genetic Variation

  21. Blood group AB O A B Blood cells antigen Continuous and DiscontinuousVariation

  22. Polygenic Inheritance

  23. Environmental Effect Temperature

  24. Chromosome Mutation MUTATION

  25. Down’s Syndrome

  26. Change in Sex Chromosomenumber

  27. AACCGTGGACAACCTTGGAC Gene Mutation Change of a gene sequence Cause: Sickle Cell anaemia

  28. Radiation: high energy particles as and also UV light. UV can combine TT nucleotide in DNA chain and so affect replication and transcription. Mutagen Mutagen is any agents which cause mutation. Chemical: colchicine inhibit spindle formation and cause polyploidy, formaldehyde, nitrous acid and mustard gas.

More Related