RNA folding, anti-HIV aptamer design, and human telomerase RNA activity

1. RNA folding, anti-HIV aptamer design, and human telomerase RNA activity Shi-Jie Chen Department of Physics & AstronomyDepartment of Biochemistry University of Missouri-Columbia

2. RNA (ribonucleic acid) Primary Structure P O c c c O P 7 torsional angles per nt to specify the 3D structure of an RNA

3. Base pairing and stacking U

4. 2D (contact map) and 3D structures Human telomerase RNA Theimer and Feigon et al, Mol. Cell., 17, 671-682, 2005

5. Telomerase controls the elongation of telomere When the telomere become critically short, the cell is unable to replicate. Thus, telomerase is important in cell division and normal development.

6. Secondary structure of human telomerase RNA (hTR) Chen, Blasco & Greider, Cell, 100, 503 (2000)

7. Need an entropy theory. Conf entropy is intrinsically a 3D problem. Vfold model S-J Chen “RNA Folding: Conformational Statistics, Folding Kinetics, and Ion Electrostatics” Annual Review of Biophysics 2008

8. RNA conformations described by torsions of the virtual bonds N1 (primidine: U, C) N9 (purine: A, G) P O C O5 C5 C4 W. Olson & Flory 1972 S Cao & S-J Chen 2008

9. Backbone virtual bond torsions are rotameric (t, g-) (g+,t) (t, g-) (t, t) (t, t) (g-, t) diamond lattice Wadley and Pyle et al. JMB, 2007 C3’-endo C2’-endo P C4 C4 C4 η θ P P N1/9 P

10. RNA conformational ensemble  Random walk of the virtual bonds in diamond lattice

11. The Vfold model – a general tool

12. Actual loop is quite rigid, how to account for this effect in the loop conformational enumeration in the Vfold model? The model requires no any fitting parameters. The computations are from first principles.

13. Sequence  structure Vfold model gives better predictions than Pknots, which ignores the contribution of loop entropy. : The free energy of the coaxial stacking between two stems (S1 and S2) Cao & Chen, Nucleic Acids Res, 2006

14. Pseudoknot motifs (b) H-type pseudoknot with structured loops (a) H-type pseudoknot SARS BWYV (c) Secondary structure + pseudoknot (d) Several H-type pseudoknots TYMV TMV

15. 2D structure prediction SE=SP=1 for perfect accuracy 28-91 nt, 22 sequences Ren, J., Rastegari, B., Condon, A., Hoos, H.H. (2005) RNA. Cao & Chen (2009) RNA

16. Free energy landscape Shi-Jie Chen. Annual Review of Biophysics 2008

17. RNA folding energy landscape is bumpy Sashital, Cornilescu & Butcher. NSMB 2004; Madhani & Guthrie. Cell 1992 Cao & Chen. JMB 2005

18. Secondary structure of human telomerase RNA (hTR)

20. Loop-stem (helix) tertiary interactions

21. Loop-helix interactions are functionally important in RNA pseudoknot  human disease : The free energy of the coaxial stacking between two stems (S1 and S2) Theimer and Feigon et al, Mol. Cell., 17, 671-682, 2005

22. Loop-stem base triple interaction 9

24. Predicting loop-stem base triple interactions • Vfold  chain entropy Protonated C.(C-G) and C.(G-C): (-14 kcal/mol, -38 cal/mol.K) unprotonated: (-7 kcal/mol, -19 cal/mol.K) +

25. The Vfold model gives good predictions on structures and folding stabilities Disruption of the loop-stem base triple

26. Nucleotide sequence  2D structure, stability, free energy landscape

27. Multiscale all-atom tertiary structure prediction RMSD = 2.2 A Sugarcane Yellow Leaf Virus (ScYLV)

28. Secondary structure can be slave to tertiary contacts. loop-helix contacts Wrong structure Correct structure Inhibition of the tertiary contact  structural switch

29. Anti-HIV RNA aptamer design • Aptamers that bind reverse transcriptase (RT) inhibit its activity in enzymatic assays and block viral replication whe expressed in cells. • Many RNA aptamers to RT form pseudoknots Donald Burke

31. A A A ACUGAA AGGGC UGACUU UUCCG U U AGA Jaeger, Restle, Steitz (1998) EMBO J

32. A A A ACUGAA AGGGC UGACUU UUCCG U U AGA Jaeger, Restle, Steitz (1998) EMBO J

33. Anti-HIV aptamer design Can computational approach guide an experimental search for new aptamers? and can experimentation guide refinement of computational theory?

34. Physics theory guides drug design 80.63 GCCACACUCCACUCUCGACCGUUUCUUGGGUUCUUCGGGAAAAAAAGCAACCUACUAUUGACUAUCGACGAAGAUCUGUU 134gauucggaugcuccgguagcucaaccug 3’ ? loop-helix contacts The location of a fluorescently labeled primer on a denaturing gel

35. Physics theory guides drug design 80.63 GCCACACUCCACUCUCGACCGUUUCUUGGGUUCUUCGGGAAAAAAAGCAACCUACUAUUGACUAUCGACGAAGAUCUGUU 134gauucggaugcuccgguagcucaaccug 3’ full length D. Burke The location of a fluorescently labeled primer on a denaturing gel

36. Pseudoknot folding kineticsand human Telomerase RNA activity

37. Telomerase controls the elongation of telomere When the telomeres become critically short, the cell is unable to replicate. Thus, telomerase is important in cell division and normal development.

38. Secondary structure of human telomerase RNA (hTR) Chen, Blasco & Greider, Cell, 100, 503 (2000)

39. Conformational switch and hTR function 179 hairpin Comolli et al. 2002 Theimer et al. 2003 pseudoknot

40. Conformational switch and hTR function 179 AG X hairpin UC X Chen & Greider 2005 (179AG/110CU mutation to destabilize the hairpin) AG pseudoknot UC

41. Rate model

42. Reduced conformational ensemble 6 40 nt: 10 confs 6000 Native-like & misfolded Cao & Chen, Biophys J. 2009

43. Theory-experiment agreement PK5 Wyatt, Puglisi, and Tinoco 1990 Cao & Chen 2005 JMB

44. hTR: hairpin as a kinetic intermediate Hairpin  pseudoknot switch exists The function may be kinetically controlled. The mutation expt alone cannot negate the role of conf switch. Cao & Chen 2005 JMB

45. We proposed two structures that are correlated to the telomerase activity: A long-lived transient hairpin intermediate & the native pseudoknot. Mutants such as 107AG and ∆U177 which forbid the formation of the native pseudoknot or hairpin intermediate result in the loss of telomerase activity.

46. Acknowledgment Song Cao Gengsheng Chen Liang Liu Zoia Kopeikin (MU) Zhijie Tan (Wuhan U) Wenbing Zhang (Wuhan U) Donald Burke (U Missouri) Juli Feigon (UCLA) David Giedroc (Indiania U) Samuel Butcher (U Wisconssin) NSF MCB 0920067, NSF MCB 0920411 NIH R01 GM 063732 Ion electrostatics Folding kinetics Tertiary structural folding