The 3R’s in animal use and a prospective in vitro screening tool for identifying potential immunotoxicants

1. The 3R’s in animal use and a prospective in vitro screening tool for identifying potential immunotoxicants Courtney E.W. Sulentic, Ph.D. Department of Pharmacology & Toxicology Boonshoft School of Medicine, Wright State University

2. Lecture Outline • Purpose of the Colgate-Palmolive In Vitro Toxicology Lecture and Luncheon • The Necessity, Public Perception, and Paradoxes of Animal Research • The 3R’s (Refinement, Reduction, Replacement) in Animal Use • In Vitro B-cell Line Model • molecular mechanisms by which dioxin inhibits B-cell function • identify chemicals that directly target and alter B-cell function

3. Colgate-Palmolive In Vitro Lecture and Luncheon • Purpose of the In Vitro Lecture and Luncheon • Feature research using in vitro and alternative techniques • study basic mechanisms • benefit animal welfare by refining, reducing, or replacing animal use • Networking opportunity with peers and professionals in academia, industry, and government • Potential for mentorship • Colgate-Palmolive Grants and Awards • Grants for Alternative Research • 15 grants (max. of $40,000) awarded since 2006 • Awards for Student Research Training in Alternative Methods • Up to five student training awards per year at $3,500 each; 23 award recipients since 2000 • Postdoctoral Fellowship Award in In Vitro Toxicology • Fellowships of up to $38,000 awarded alternate years; 17 awarded since 1988 • Traveling Lectureship in Alternative Methods in Toxicology Award • 16 awarded since 1996

4. Is Research with Animals Necessary? • Responsible for great advances in biomedical research • Most national laws require animal data for safety analysis of new drugs and medical devices • SOT Policy Statement: • necessary to ensure and enhance human and animal health and protection of the environment • in absence of human data, most reliable means of detecting important toxic properties of chemical substances and for estimating risks to human and environmental health • Ethical, Emotional, and Political Issue • relative value or moral value of humans and animals • When needs of animals and humans come into conflict which takes precedence? • Wide spectrum of views on this!

5. Public Perception • Animal “rights” versus animals as a resource to be exploited • Animal worship by ancient societies • recognition of the crucial role of animals in sustaining human life • Competition with animals for basic resources • species survival and environmental impact • Subliminal and overt messages that animal research is wrong • Animal rights organizations and websites • PETA, Human Seal, StopAnimalTests.Com, etc. • Children’s books and movies • Nancy Drew: The Teen Model Mystery by Carolyn Keene • The Secret of NIMH (National Institute of Mental Health), 1982 animated film based on a Newberry Medal-winning book written by Robert C. O’Brien • Celebrities

6. Public Perception “Today's non-animal research methods are humane, more accurate, less expensive, and less time-consuming than animal experiments, yet change comes slowly and many researchers are unwilling to switch to superior technological advances. Animal experimentation not only is preventing us from learning more relevant information, it continues to harm and kill animals and people every year. “ -www.stopanimaltests.com “It is generally accepted within the laboratory animal science community that it is impossible to completely replace the complex physiology and multiple organ systems of live animals with any form of alternatives.“ -Guhad, Contemporary Topics 44:58-59, 2005 www.humanseal.org

7. The Paradox of Animal Research “Ask the experimenters why they experiment on animals, and the answer is: 'Because the animals are like us.' Ask the experimenters why it is morally OK to experiment on animals, and the answer is: 'Because the animals are not like us.‘ Animal experimentation rests on a logical contradiction." -Professor Charles R. Magel Animal rights activists use the same rationale – “Because the animals are like us” – to argue against animal research.

8. The Paradox of Animal Research • appeals to emotion or logic are unlikely to resolve the debate over the use of animals in research • tendency to assign roles and labels may profoundly influence ethical decision making • results in paradoxes and inconsistencies in the moral status of animals Herzog, American Psychologist 43:473-474, 1988

9. Paradox Examined: The Moral Status of Mice • The Good Mice: “guinea pig”, test subject • existence depends on utility like any other domestic animal • entitled to the protection of the U.S. Department of Agriculture (USDA) and oversight of the animal use and care committee • The Bad Mice: pest • free-ranging animals that are a legitimate contamination threat • no protection, must be eliminated • poison, snap trap, “sticky trap” • The Feeder Mice: food • adult, juveniles or newborns fed to carnivorous species (snakes, lizards, large toads) used in research or as pets • mammals are covered by the Animal Welfare Act and are deemed worthy of protection by USDA, whereas snakes and other “lower” vertebrates are specifically excluded • The Pet Mice Herzog, American Psychologist 43:473-474, 1988

10. Animal Welfare “I am not interested to know whether vivisection produces results that are profitable to the human race or doesn’t. … The pain which it inflicts upon unconsenting animals is the basis of my enmity toward it, and it is to me sufficient justification of the enmity without looking further.“ -Mark Twain (1835-1910) If animal research is necessary as most biomedical and basic scientists and toxicologists would agree it is, then we have an ethicalobligation to assure that we are good stewards of the research animals and that the potential pain and discomfort is as minimal as possible.

11. Animal Welfare “It is universally accepted that good animal welfare contributes to good science, while poor animal welfare can only subtract from good science. Knowledge of an implementation of the 3R’s can be a proactive response to animal welfare by the primary users of research animals. Leadership in this area rightly belongs to scientists, animal technicians, veterinarians, and managers of research institutions and less to politicians or militant animal activists.” -Guhad, Contemporary Topics 44:58-59, 2005

12. Animal Welfare Act • Institutional Animal Care and Use Committee (IACUC) • federally mandated at each research institution that uses animals • at least five members • veterinarian with program responsibilities • scientist experienced in laboratory animal research • non-scientist • individual with no affiliation with the institution • authority to suspend research activities • evaluates animal use program and facilities • reviews and approves all animal use protocols • Bad mice (pests) and sticky traps

13. The 3R’s of Animal Use • Refinement • minimize pain or distress including proper euthanasia • Reduction • minimize the number of animals • good experimental planning that includes pilot studies, maximize information gathered, minimize variables (disease, stress, diet, genetics, etc.), power analysis, literature search to avoid duplication, use of appropriate species • Replacement • replace with “lower” animals • Microorganisms, plants, eggs, reptiles, amphibians, invertebrate • replace with non-animal in vitro models and computer modeling -Russell and Burch, The Principles of Humane Animal Experimental Techniques, 1959

14. The 3R’s of Animal Use: Replacement • Replacement • Advantage • apply known principles to new systems • extend mechanistic studies in technically less challenging cellular models • Use less expensive “lower” animals or cellular models to screen large numbers of agents for toxicity and mutagenicity • Disadvantage • models dependent on pre-existing information • difficult to incorporate the complexity of living organisms • unknown variables in physiology and pathology • new biological processes will require validation in living organism

15. Lecture Outline • Purpose of the Colgate-Palmolive In Vitro Toxicology Lecture and Luncheon • The Necessity, Public Perception, and Paradoxes of Animal Research • The 3R’s (Refinement, Reduction, Replacement) in Animal Use • In Vitro B-cell Line Model • molecular mechanisms by which dioxin inhibits B-cell function • potential to Identify chemicals that directly target and alter B-cell function

16. O Cl Cl 1 9 8 2 7 3 4 6 Cl O Cl 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD or dioxin)

17. Profile of Biological Activity by TCDD • enzyme induction (hallmark response) • hepatomegaly • lymphoid involution: primarily thymus • immunomodulation (mostly suppression) • chloracne and epithelial hyperplasia • teratogenesis (cleft palate) • cancer (tumor promoter) • wasting syndrome • death Immunity: resistance of an organism to infection, disease, or other unwanted biological invasion

18. Rationale for Focusing on B cells • The antibody response has historically been one of the most sensitive indicators of TCDD immunotoxicity. • Various studies have identified B cells as a direct and sensitive cellular target of TCDD. Immunotoxicology: Evaluating the structure and function of the immune system following exposure to chemicals (environmental agents, pharmaceuticals, substances of abuse, dietary components including herbal remedies and supplements).

19. Proliferation B cells: Effector Cells of Humoral Immunity TCDD Resting or naive Activation Differentiation

20. µ d g3 g1 g2b g2a e a 3’IgH RR VH VDJ Em hs4 hs3a hs3b hs1,2 Antibody Structure and Isotypes Immunoglobulin heavy chain (IgH) gene locus

21. How does TCDD inhibit B cell function?

22. c-src? AIP AIP ARNT ARNT ARNT Aryl Hydrocarbon Signaling Pathway PCDD c-src? PCDF PCBs AhR PBBs HSP AhR HSP HSP 90 90 90 HSP 90 HSP AhR 90 Cytosol HSP 90 HSP AhR 90 Nucleus HSP 90 AhR Cyp1A1 IgH gene too? AhR DNA TNGCGTG DRE

23. Mouse IgH locus µ d g3 g1 g2b g2a e a 3’IgH RR VH VDJ Em hs4 hs3a hs3b hs1,2 Hypothesis • Inhibition of B-cell function by TCDD is transcriptionally mediated by the AhR which binds DREs within regulatory regions of genes required for Ig expression. • In vitro model: CH12.LX B-cell line • derived from a mouse B-cell lymphoma • extensively utilized to study cellular processes specific to B cells • useful model in studying the effects of TCDD on B-cell function • validation of results in primary B cells or mouse in vivo models

24. ARNT ARNT The AhR/ARNT heterodimer binds to DRE sites within the 3’IgHRR µ d g3 g1 g2b g2a e a 3’IgH RR hs4 VH VDJ Em hs3a hs3b hs1,2 AhR hs1,2 TAGGGGTCTATTAACTCACCACGCTAGGCCATCATGGAGAG DRE AhR hs4 AGCAGAGGGGGGGACTGGCGTGGAAAGCCCCATTCACCCAT DRE

25. The mouse 3’IgHRR is a sensitive transcriptional target of TCDD unstimulated LPS stimulated 25 20 15 g2b expression (ng/2mg total protein) ** 10 ** ** †† 5 Cg2b 0 g2b transgene expressed in the CH12.g2b-3’IgH in vitro B-cell model NA LPS DMSO 0.1 1.0 10 30 3a 1,2 3b 4 VH nM TCDD 3’IgHRR

26. A diverse range of chemicals bind the AhR and inhibit the 3’IgHRR 125 IC50 TCDD 5.6x10-10 ICZ 1.1x10-7 Primaquine 2.6x10-5 Omeprazole 3.9x10-5 Carbaryl 4.7x10-5 100 75 g2b IgH protein (% effect) 50 25 0 VH 10 -11 10 -9 10 -7 10 -5 10 -3 NA Molar Concentration

27. Inhibition of the 3’IgHRR correlates with inhibition of endogenous IgA unstimulated LPS stimulated 100 75 ** ** ** †† IgA protein expression (ng/2mg total protein) ** 50 ** 25 0 DMSO (0.1%) NA LPS DMSO (0.01%) TCDD ICZ PMQ CBRL OME

28. unstimulated LPS stimulated Chemicals other than AhR activators modulate 3’IgHRR activity ** ** 350 300 250 200 g2b expression (% effect relative to LPS) 150 100 50 0 NA LPS 20 30 40 50 10 mM H2O2 ** 150 350 300 * 250 100 200 g2b expression (% effect relative to LPS) g2b expression (% effect relative to LPS) 150 ** Cg2b 50 100 3a 1,2 3b 4 VH 50 † †† 0 0 3’IgHRR NA LPS 0.5 2.75 5.0 DMSO NA LPS 0.1 1.0 10 100 mM BITC mM Terbutaline

29. Effects on the 3’IgHRR correlate with effects of endogenous IgA unstimulated LPS stimulated 200 * 150 IgA protein expression (% effect relative to LPS) 100 * * 50 † †† †† 0 NA LPS DMSO (0.01%) TCDD CBOL TERB NA LPS NA LPS DMSO (0.05%) BITC H2O2

30. Summary • Chemical-induced effects on 3’IgHRR activity mirror the effects on endogenous IgH expression and antibody-mediated function. • Ourin vitro B-cell line model will provide a useful tool in understanding the mechanisms of altered IgH transcriptional regulation by chemicals. • With further validation our model may be useful in identifying potential immunotoxicants that directly target and alter B-cell function. • A diverse range of chemicals from environmental, dietary, and pharmaceutical origin have the potential to modulate 3’IgHRR activity which may have significant human health and clinical implications.

31. Human Diseases Associated with the 3’IgHRR • Burkitt’s lymphoma • Chromosomal translocation between the c-myc locus (chr. 8) and the Ig loci (chr. 2, 14, or 22). • Most common is chromosome 8 to 14 translocation which links the c-myc proto-oncogene to the IgH gene and to the 3’IgH RR. • IgA nephropathy • Most common cause of renal failure. • Severity and rapid evolution to renal failure associated with a polymorphic hs1,2 enhancer. • Increased number of tandem repeats containing a kB and DRE with a high degree of similarity to the mouse hs1,2 kB and DRE. • Celiac disease • Fairly common disease of the small intestine. • Occurrence associated with polymorphic hs1,2 enhancer. • Systemic sclerosis, plaque psoriasis, psoriatic arthritis, dermatitis herpetiformis

32. Acknowledgements My Mentors Norbert Kaminski (Michigan State University) Sulentic Lab Eric Romer DiliniRanatunga Rebecca Henseler Rick Salisbury (#1289) TharuFernando (#249) Dave Ellis (#248) Roger Fecher Ruth Chambers- Turner Mike Wourms Sharon Ochs Geoffrey Haughton (University of North Carolina) Laurel Eckhardt (Hunter College of CUNY) Leonard Bjeldanes (University of California Berkeley) Sanjay Srivastava (Texas Tech University) Thomas Brown (Wright State University) Michael Denison (University of California Davis) Society of Toxicology In Vitro and Alternative Methods Specialty Section Support by Colgate-Palmolive Grant NIEHS RO1ES014676 WSU Boonshoft School of Medicine Research Challenge Grant