1 / 54

Mechanisms of solvent tolerance in Pseudomonas putida

Mechanisms of solvent tolerance in Pseudomonas putida. Juan L. Ramos & Ana Segura, Antonia Rojas, Wilson Terán, M. Trini Gallegos, Estrella Duque. Solvent-tolerant microbes are envisaged as powerful tools for:. Decontamination of sites heavily polluted with solvents

blue
Download Presentation

Mechanisms of solvent tolerance in Pseudomonas putida

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Mechanisms of solvent tolerance in Pseudomonas putida Juan L. Ramos & Ana Segura, Antonia Rojas, Wilson Terán, M. Trini Gallegos, Estrella Duque

  2. Solvent-tolerant microbes are envisaged as powerful tools for: • Decontamination of sites heavily polluted with solvents • Biotransformations in double-phase systems • Biosensors

  3. *Inoue and Horikoshi, 1991, Nature 338, 264-266 Pseudomonas putida, toluene tolerant *Cruden et al., 1992, Appl. Environ. Microbiol. 58, 2723-2729 P. putida , p-xylene tolerant *Weber et al., 1993, Appl. Environ. Microbiol. 59, 3502-3504 P. putida, styrene tolerant *Ramos et al., 1995, J. Bacteriol. 177, 3911-3916 P. putida, toluene tolerant and able to use toluene as the only carbon source

  4. O2 O2 X F C1 C2 B A D E G I H S T NAD+ (todD) NADH+H+ CH 3 toluene ISPTOL NAD+ FerredoxinTOL ReductaseTOL (todC1C2) (todB) (todA) NADH+H+ FerredoxinTOL ReductaseTOL ISPTOL CH 3 H OH OH H cis-toluene dihydrodiol CH 3 OH OH 3-Methylcatechol (todE) Ring fission

  5. Growth of P. putida DOT-T1E in the presence of organic solvents log Pow Solvent Growth (OD660) n-Decane n-Octane n-Heptane Propylbenzene Diethylphthalate Cyclohexane Ethylbenzene p-xylene Styrene Toluene 1-Heptanol Dimethylphthalate Benzene Chloroform Butanol 5.6 4.5 4.1 3.6 3.3 3.2 3.1 3.1 3.0 2.5 2.4 2.3 2.0 2.0 0.8 >2.0 >2.0 >2.0 >2.0 >2.0 >2.0 >2.0 >2.0 >2.0 >2.0 >1.0 >1.0 <0.1 <0.1 <0.1

  6. Why are Pseudomonas DOT-T1E and other strains tolerant to toluene? • Physical barriers that increase membrane rigidity • Biochemical barriers that involve removal of toluene by efflux pumps

  7. PHYSICAL BARRIERS (cis -> trans isomerization, Cardiolipin biosynthesis, Fatty acid metabolism) TtgJ Constitutive and inducible Efflux pumps BIOCHEMICAL BARRIERS

  8. LB+tol(g) LB -0.3% tol +0.3% tol -0.3% tol +0.3% tol 10-1 10-3 10-1 10-3 10-1 10-3 10-1 10-3 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10-5 10-5 10-5 10-5 10-7 10-7 10-7 10-7

  9. DOT-T1E (wild type) 10 log CFU/ml 5 0 20 40 60 0 time (minutes)

  10. PHYSICAL BARRIERS • Cis  trans isomerization of unsaturated fatty acids • Biosynthesis of cardiolipin

  11. LB LB +1%(v/v) toluene C14:0 C16:1 cis C16:1 trans C16:0 C17:cyclopropane C18:2 cis cis C18:1 cis ol C18:1 cis va C18:1 trans va C18:0 cis/trans saturated/unsaturated 1.0 15.4 3.1 55.0 1.1 1.0 4.0 13.3 0.0 0.95 10.7 1.3 1.0 8.3 10.3 53.3 1.0 1.0 3.0 10.0 3.9 0.9 1.5 1.2

  12. 5´-CATAGGAACTACCTGGTCGGGCGAATATCAGAAGGTGCCGAATCATAACAAA GCTGCGCGGTTTTTAGGCATGTCGCCCATTTGCATGAAAACTGCTCATGTTG GGCGGGTGGAGGCAGCGCAAGGCACCCAGGACGACCAGGCAACAAATCGTGA TGGCTTTCAAGAACCAGGACTTTCCGCACATG-3´ 182bp metH cti act 194bp 5´-TGATCGGGTTGGCTGACCTTTCCGAGTACCTTGCGGTCGGAATGGGTG GGTGGTCTTGATCGATTGCAAAGGGGGCTGCTTTGCAGCCCTTCGCGG GTGAACCCGCTCCTACAACAGGTACGGCGCTGCTCTGAAGGCTGGCGC TGGCCTCTGCACTCGATACGGGCCTCAATGCACCGCCAAGCGCAGGGT ATTCCATG-´3 BglII SphI BglII SphI 2.9 kbp 1.6 kbp 2.4 kbp  6.9 kbp

  13. BglII BamHI BglII BamHI KpnI BglII 0,8 kbp 1,5 kbp 1,6 kbp 0,57kbp ctiT1 N-terminal region ctiT1 N-terminal region

  14. Fatty acid Growth conditions LB LB plus heptane C14:0 C16:1,9 cis C16:1,9 trans C16:0 C17:cyclopropane C18:2 C18:1,9 cis ol C18:1,11 cis vac C18:1,11 trans vac C18:0 2 8 0 54 17 1 1 16 0 2 1 10 0 50 4 1 3 26 0 8 DOT-T1E-P4

  15. 0.8 0.6 0.4 0.2 0 2 4 6 8 10 12 Turbidity (OD 660nm) Time (hours)

  16. Head group phospholipid composition of P. putida DOT-T1 growing in the absence and in the presence of organic solvents PE Organic solvent PE PG CL PG+CL None 78 10 12 3.5 Toluene (1% v/v) 65 9 26 1.8

  17. CL BIOSYNTHESIS TAKES PLACE AT THE EXPENSE OF PG • 32P incorporation assays indicates that in the presence of toluene the rate of CL synthesis is twice as high as in the absence of the solvent. • The Pseudomonas putidacls gene has been cloned, mutated in vitro and inactivated in vivo by homologous recombination. • The response of a cls mutant to toluene shocks has been analyzed. Under a any growth conditions a solvent shock resulted in a survival that is two orders of magnitud below that of the wild-type strain.

  18. Conclusions • The main alterations in response to toluene observed in Pseudomonasputida are: cis -> trans isomerization of unsaturated fatty acids and increase in the level of cardiolipin. • A cti mutant of Pseudomonas putida DOT-T1 exhibited a delay in growth in response to solvents, but it was as tolerant as the wild-type to sudden solvent shocks. • A cls mutant of Pseudomonas putida DOT-T1 is more sensitive to solvent shocks than the wild-type strain.

  19. Solvents Fatty acids saturated cis-isomer trans-isomer

  20. EFFLUX PUMPS

  21. Solvent tolerance is an energy-dependent process Incorporation of 1,2,4-[14C]-trichlorobenzene into membranes of P. putida cells 14C/mg cell protein Conditions Untreated 20.000 FCCP-treated 300.000

  22. Isolation of Tn5 solvent-sensitive mutants of Pseudomonas putida DOT-T1E • 1) Mutants that simultaneously exhibited increased sensitivity to solvents and antibiotics (ampicillin, chloramphenicol and tetracycline) • 2) Mutants that exhibited increased sensitivity to solvents but retained the wild-type level of resistance to ampicillin, chloramphenicol and tetracycline

  23. DOT-T1E KT-2440 DOT-T1E-18 9 log CFU ml-1 5 1 0 40 0 20 40 0 20 40 20 Time (min)

  24. Incorporation of 1,2,4-[14C]-trichlorobenzene into membranes of P. putida cells Culture Conditions 14C/mg cell protein Wild-type DOT-T1E18 LB 20.000 280.000 LB+ toluene 30.000 252.000

  25. A G T C 1 2 3 4 ttgC ttgB ttgR ttgA ttgE ttgF ttgT ttgD -tol +tol A C G T ttgI ttgW ttgH ttgV ttgG

  26. CH CH CH CH CH 3 3 3 3 3 TtgC Outer membrane TtgA Periplasmic space TtgB CH 3 Inner membrane ?

  27. A G T C 1 2 3 4 ttgC ttgB ttgR ttgA ttgE ttgF ttgT ttgD -tol +tol A C G T ttgI ttgW ttgH ttgV ttgG

  28. 20 40 0 20 20 20 40 40 40 0 0 0 TtgDEF TtgGHI Wild-type TtgABC 9 5 Viable cells (log CFU ml-1) DOT-T1E-18 DOT-T1E-28 DOT-T1E DOT-T1E-1 Time (min)

  29. A G T C 1 2 3 4 ttgC ttgB ttgR ttgA ttgE ttgF ttgT ttgD -tol +tol A C G T ttgI ttgW ttgH ttgV ttgG

  30. PttgABC T T T A C A A A C A A C C A T G A A T G T A A G T A T A T T PttgR G G A A T A T A C T T A C A T T C A T G G T T G T T T G T A A -35 PttgABC-PttgR DNA (10nM) -10 B2 B1 0 TtgR (nM) 1000 U +1 -10

  31. Substrates TtgABC TtgDEF TtgGHI Toluene Styrene m-xylene Propylbenzene Ethylbenzene + + - - - + + + + + + + + + + + + + - + + + + + - + + Tetracycline Ampicillin Chloramphenicol Gentamicin Nalidixic Carbenicillin - - - - - -

  32. 20 40 0 20 20 40 40 0 9 5 Viable cells (log CFU ml-1) DOT-T1E-18 DOT-T1E-109 DOT-T1E 0 Time (min)

  33. Expression of solvent-tolerant efflux pumps in the wild-type and the TtgJ mutant background Strain Fusion -galactosidase (Units) -Toluene +Toluene Wild-type PttgA:lacZ 50 70 PttgD:lacZ 10 20 PttgG:lacZ 400 1000 DOT-T1E-109 PttgA:lacZ 70 110 PttgD:lacZ 210 1600 PttgG:lacZ 1000 3750

  34. Incorporation of 1,2,4-[14C]-trichlorobenzene into membranes of P. putida cells Culture Conditions 14C/mg cell protein DOT-T1-109 Wild-type LB 20.000 30.000 LB+ toluene 30.000 82.000

  35. 109+tolueno 109

  36. 120 120 120 120 5 5 5 5 30 30 30 30 60 60 60 60 Incorporation of 13C-acetate in fatty acids T1E +tol T1E 109 109+tol 8 7 6 5 Relative increase of 13C 4 3 2 1

  37. The TtgJ protein 1 198 433 467 565 272 Fatty acid Acyl-CoA synthetase motif ATP-binding P-loop motif The TtgJ protein exhibits 38-45% similarity with the FadD protein of several microorganisms, i.e. Pseudomonas putida, Pseudomonas aeruginosa, Bacillus subtilis, Mycobacterium tuberculosis, etc The TtgJ protein exhibits 42% identity with an orf of Pseudomonas aeruginosa that probably encodes for an acetyl-CoA synthetase The TtgJ protein does not complement an E.coli fadD mutant

  38. 120 120 120 120 5 5 5 5 30 30 30 30 60 60 60 60 Incorporation of 13C in proteins T1E +tol T1E 109 109+tol 8 7 6 5 Relative increase of 13C 4 3 2 1

  39. Signal-CoA TtgJ Signal -X Inhibits biosynthesis of phospholipids Estimulates transcription of ttgDEF/ttgGHI

  40. Conclusions • Biosynthesis of fatty acids is essential for solvent tolerance. In a ttgJ mutant background in which fatty acid biosynthesis is impeded, blebs are formed and cells become extremely solvent sensitive. • Three efflux pumps are involved in solvent tolerance. Two of the pumps (TtgDEF and TtgGHI) are overexpressed in a mutant background deficient in the TtgJ protein. • The TtgJ protein, that exhibits features of acyl-CoA synthases, might function as a sensor system for alarmone molecules produced in response to the presence of solvents

  41. Solvent-tolerant bacteria allowing a broader performance of biotransformations of organic compounds in two-phases fermentation systems EEZ

  42. O2 O2 X F C1 C2 B A D E G I H S T NAD+ (todD) NADH+H+ CH 3 toluene ISPTOL NAD+ FerredoxinTOL ReductaseTOL (todC1C2) (todB) (todA) NADH+H+ FerredoxinTOL ReductaseTOL ISPTOL CH 3 H OH OH H cis-toluene dihydrodiol CH 3 OH OH 3-Methylcatechol (todE) Ring fission

  43. Plasmid pWWO Tra/Rep C H L B J K R F A M T J O C tnpA I G N N (Tn 4653 ) tnpT S X K B pWW0 tnpS 117 kb G H res B E xylR H H tnpA I xylS Operón (Tn 4651 ) F upper V Operón D F meta Q G D E I D J XhoI C A E EcoRI P A HindIII Tn4653 Tn4651 EEZ

  44. xyl U W C M A B N Pu COOH CHO CH CH2OH 3 xylC xylB xylMA R1 R1 R1 R1 R2 R2 R2 R2 xyl X Y Z L E G F J Q K I H Pm OH COOH CO2 OH OH HOOC OH OH COOH OH H O xylE xylXYZ xylL COOH R1 R1 R1 xylG R1 COOH R2 R2 R2 R2 R2 xylF R1COOH xylH O O O CH3COCOOH COOH COOH xylK COOH xylJ xylI + COOH R2CH2CHO EEZ OH CO2 R2 R2 R2

  45. s s s 70 70 70 - + xyl U W C M A B N Pu xyl X Y Z L E G F J Q K I H xyl S R Pm s 54 s s 70 38 / s 54 Toluene degradation pathway encoded inplasmid pWWO CH OH COOH OH 3 OH COOH O Krebs cycle B MA C XYZ+L E F... H OH 3- Methyl-benzoate - xyl Ps2 Ps1 Pr1 Pr2 + - + + HU IHF EEZ xylene

  46. xyl X Y Z L E G F J Q K I H xyl U W C M A B N Pu Pm OH CH OH 3 R1 R1 R2 R2 xylE Sm Catechol and methylcatechol bioproduction xylCMABN xylXYZL pWW0 EEZ

  47. COOH COOH CH 3 CH 3 R1 R1 R1 R2 R2 R2 R1 R2 OH COOH CO2 OH OH HOOC OH OH COOH OH H O xylXYZ xylL COOH R1 R1 R1 xylG R1 COOH R2 R2 R2 R2 R2 xylF xylH O O O CH3COCOOH COOH COOH xylK COOH xylJ xylI + COOH R2CH2CHO OH CO2 R2 R2 R2 Nitrobenzoates synthesis xyl X Y Z L E G F J Q K I H xyl U W C M A B N Pu Pm CHO CH2OH xylC xylB xylMA R1 R1 R2 R2 xylE R1COOH EEZ

  48. xylC COOH CH COOH CH 3 3 xylUWCMABN NO2 NO2 NO2 NO2 xyl S xylR xyl U W C M A B N xyl X Y Z L E G F J Q K I H Ps1-2 Pr1-2 Pu Pm STOP Toluenes Benzyl-alcohol p-chlorobenzaldehyde p-nitrotoluene m-nitrotoluene Nitrobenzoates synthesis COOH CHO CH CH2OH 3 xylB xylMA EEZ

  49. CHO CHO R1 R2 CH R1 3 R2 R1 xyl X Y Z L E G F J Q K I H Pm R2 p- and m-nitrobenzaldehydes synthesis xyl U W C M A B N Pu COOH CH CH2OH 3 xylC xylB xylMA R1 R1 R1 R2 R2 R2 COOH OH CO2 OH OH HOOC OH OH COOH OH H O xylE xylXYZ xylL COOH R1 R1 R1 xylG R1 COOH R2 R2 R2 R2 R2 xylF R1COOH xylH O O O CH3COCOOH COOH COOH xylK COOH xylJ xylI + EEZ COOH R2CH2CHO OH CO2 R2 R2 R2

More Related