1 / 70

Unraveling DNA: Structure & Replication | History & Significance

Delve into the fascinating world of DNA - learn its structure, replication process, and historical milestones like Watson & Crick's discovery. Discover the genetic code of life and explore DNA's crucial role in living organisms. Join us in unraveling the mysteries of DNA!

bookerjones
Download Presentation

Unraveling DNA: Structure & Replication | History & Significance

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. DO Now- 2/27 • Blonde hair is dominant to blonde hair. A heterozygous female is crossed with a heterozygous male… Punnett’s Square and phenotype/genotype ratios OR • What is DNA? OR • Where is DNA found?

  2. TAKE YOUR MITOSIS PROJECTS HOME!!!! I’m throwing them out tmw. Zebrafish booklets and test: last day TODAY!

  3. DNA(Deoxyribonucleic Acid)

  4. Genetic material of cells… • GENES – units of genetic material that CODES FOR A SPECIFIC TRAIT • Called NUCLEIC ACIDS • DNA is made up of repeating molecules called NUCLEOTIDES

  5. DNA STRUCTURE • DNA had specific pairing between the nitrogen bases: • ADENINE (A) – THYMINE (T) • CYTOSINE (C) – GUANINE (G) • “Complementary Rule”:DNA made of 2 long stands of nucleotides arranged in a specific way

  6. Nucleotides – DRAW THIS!!! Phosphate Nitrogenous Base (A, T, C, G) Sugar

  7. A or G T or C Nitrogenous Bases • PURINES 1. Adenine (A) 2. Guanine (G) • PYRIMIDINES 3. Thymine (T) 4. Cytosine (C)

  8. “Rungs of ladder” Nitrogenous Base (A,T,G or C) “Legs of ladder” Phosphate & Sugar Backbone DNA Double Helix

  9. 5 O 3 3 O P P 5 5 C O G 1 3 2 4 4 2 1 3 5 O P P T A 3 5 O O 5 P P 3

  10. C T A G Chargaff’s Rule • Adeninemust pair with Thymine • Guanine must pair with Cytosine • Their amounts in a given DNA molecule will be about the same.

  11. H-bonds G C A T BASE-PAIRINGS

  12. DNA Structure Review Questions • What does DNA stand for? • DNA is made of repeating units of __________________ • A nucleotide is made of: …? • Draw a nucleotide. • What are the 4 nitrogenous bases? • What are the two PURINES? Are they Big or little?

  13. DO Now- 2/28 • What makes up DNA? OR • Draw a picture of what DNA looks like? OR • What are the 4 bases?

  14. TAKE YOUR MITOSIS PROJECTS HOME!!!! I’m throwing them out tmw. Students Run Quiz Thursday

  15. A HISTORY OF DNA • Discovery of the DNA double helix A. Frederick Griffith – Discovers that a factor in diseased bacteria can transform harmless bacteria into deadly bacteria (1928) B. Rosalind Franklin- X-ray photo of DNA. (1952) C. Watson and Crick- described the DNA molecule from Franklin’s X-ray. (1953)

  16. History Continued • Hershey & Chase– • 1952, proved DNA determined proteins • Used bacteria and bacteria viruses to show DNA responsible for heredity • Chargaff—Chargaff’s rules. • Using ratio of nitrogenous bases in DNA, showed complimentary bases.

  17. Genetic Diversity… • Different arrangements of NUCLEOTIDES in a nucleic acid (DNA) provides the key to DIVERSITY among living organisms.

  18. The Code of Life… • The “code” of the chromosome is the SPECIFIC ORDER that bases occur. A T C G T A T G C G G…

  19. DNA is wrapped tightly around histones and coiled tightly to form chromosomes See p. 297

  20. Questions: • Complete the questions on page 202 on a separate piece of paper (1 – 11). Please write the question and just your answer. • Skip question 2 and 10 • #5  just the definitions of the 3 words

  21. Do Now – 3 /19 • What is the structure of DNA? OR • What are nucleotide bases?

  22. STEP 1: Helicase unwinds, unzips STEP 2: DNA polymerase adds bases as it reads strand (leading and lagging strand) STEP 3: Ligase checks and binds all fragments together (finishing touch)

  23. DNA Replication • DNA must be copied • The DNA molecule produces 2 IDENTICAL new complementary strands following the rules of base pairing: A-T, G-C • Replicates using the enzyme DNA polymerase

  24. DNA Template Parental DNA New DNA DNA Replication • Semiconservative Model: 1.Watson and Crick showed: the two strands of the parental molecule separate, and each functions as a template for synthesis of a new complementary strand. .

  25. DNA Polymerase – Enzyme for DNA Replication • Reads original strand 3’  5’ • New strand created 5’  3’ • DNA Helicase – Enzyme that unwinds the DNA

  26. DRAW THIS!!!!!!!!!

  27. (1961) Watson & Crick proposed… • …DNA controlled cell function by serving as a template for PROTEINstructure. • 3 Nucleotides = a triplet or CODON (which code for a specific AMINO ACID) • AMINO ACIDS are the building blocks of proteins.

  28. Replication – Checking for Understanding 1. Why is replication necessary? 2. Who proposed the replication concept? 3. What is the replication process called? • Use the complementary rule to create the complementary strand: A---? G---? C---? T---? A---? G---? A---? G---? C---? A---? G---? T---?

  29. Questions: • Answer the questions on page 200 (section 3 review) in your notebook • I will check and grade them before you leave.

  30. DNA Replication Review Question • Draw a picture of DNA replication at the replication fork. • What are the 2 enzymes involved in replication? • What is DNA replication called (the name of the model proposed by Watson and Crick)? • What is the difference between the leading and lagging strands? • What is the complementary strand to the following: ATTAGCTAGGACT

  31. EXIT TICKET 1. Draw a picture of a DNA strand. 2. Write the complementary strand to the following: AAATTTCCCGGG

  32. Do Now – 3/9 • What are the 3 parts of DNA • What are the two enzymes in DNA replication? • What is the shape of DNA CHOOSE ONE!!!!!!!

  33. CLASSWORK 3/9 • Define the words on page 221 on back of worksheet (Section 1 vocab) • Any 6 questions from the worksheet • Chapter 9

  34. Classwork: • Turn to page 202 in the Biology textbook • One a SEPARATE SHEET OF PAPER: • Answer questions 2, 4, 5, and 8-15 • You MUST write the question

  35. Do Now – 4/10 • What are the 3 parts of DNA • What are the 3 steps in DNA replication • What are the steps of transcription? CHOOSE ONE!!!!!!!

  36. DNA RNA Protein Transcription and Translation: An Overview (aka the Central Dogma) Transcription – in nucleus Translation – in cytoplasm, on ribosomes

  37. DNA Double stranded Deoxyribose sugar Bases: C,G A,T RNA Single stranded Ribose sugar Bases: C,G,A,U RNA vs. DNA Both contain a sugar, phosphate, and base.

  38. DNA can “unzip” itself and RNA nucleotides match up to the DNA strand. • Both DNA & RNA are formed from NUCLEOTIDES and are called NUCLEIC acids.

  39. Transcription • DNA  RNA • Happens in the NUCLEUS • RNA forms base pairs with DNA • C-G • A-U • mRNA- type of RNA that encodes information for the synthesis of proteins and carries it to a ribosome from the nucleus

  40. RNA polymerase- complex of enzymes, like DNA polymerase STEP 1: RNA Primer binds to the parent DNA strand before gene to be transcribed • STEP 2: Unwind DNA sequence (RNA Polymerase) • STEP 3: Produce primary transcript by stringing together the chain of RNA nucleotides (RNA Polymerase)

  41. mRNA Processing • Primary transcript is not mature mRNA • DNA sequence has coding regions (exons) and non-coding regions (introns) • Introns must be spliced out before mRNA can leave nucleus

  42. TRANSCRIPTION ACGATACCCTGACGAGCGTTAGCTATCG GGG ACU UGC UAU

  43. Classwork: 1. In your notebook, fill out the two charts below with 3 facts in each box: 2. What is RNA polymerase? 3. What would be the corresponding mRNA sequence for the following DNA strand: ATTCGATTCGATATACTAGCTAGCT

  44. Do Now 4/11 1. What is RNA polymerase? OR 2. What would be the corresponding mRNA sequence for the following DNA strand: ATTCGATTCGATATACTAGCTAGCT

  45. Q4 Project: Genetic Disease In your visual: Can be a powerpoint, poster, brochure, etc. Aesthetics do count!!! Should have pictures and info In your paper: • 2 pages single spaced handwritten • 2 pages double spaced typed • You MUST include a bibliography of 3 sources (Textbook is ok)

  46. Q4 Project: Genetic Disease In your visual: Pictures of disease (if appropriate) Major information in bullet point format Should include all information outlined in your paper • In your paper: • Symptoms and problems associated • How it is passed through generations (dominant, recessive, sex linked) • When it was discovered, how it was discovered, and by whom (which scientists) • Outcomes and treatments

  47. DUE DATES • Disease Choice: TODAY (10 Points) look on page 181 for ideas (if you have another make sure I clear it first • Rough Draft Due: Friday, April 20th (40 Points) • Final (Visual and Paper):Friday, April 27th (150 Points) • TOTAL: 200 Points, Test Grade

  48. Q4 Project: Genetic Disease • RUBRICS

  49. Do Now 4/12 1. What are the 4 steps in transcription? OR 2. Compare DNA and RNA.

More Related