1 / 1

Rap2.10

Rap2.4a. Rap2.6. Rap2.2. ERF4/Rap2.5. Rap2.3. Apetala2. Rap2.7. Rap2.8. Rap2.1. Rap2.10. CBF1. DREB2A. A. B. -721. -673. -628. -616. -529. -511. -451. -438. -294. 13 bp. F1 (48 bp). - +. + +. DNA Protein. F2 (105 bp). F3 (117 bp). F4 (90 bp). F5 (158 bp).

boris
Download Presentation

Rap2.10

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Rap2.4a Rap2.6 Rap2.2 ERF4/Rap2.5 Rap2.3 Apetala2 Rap2.7 Rap2.8 Rap2.1 Rap2.10 CBF1 DREB2A A B -721 -673 -628 -616 -529 -511 -451 -438 -294 13 bp F1 (48 bp) - + + + DNA Protein F2 (105 bp) F3 (117 bp) F4 (90 bp) F5 (158 bp) RAP2.4a + 13 bp F1 F2 F3 F4 F5 free RAP2.4a DNA Protein - + + + - + + + - + + + - + + + - + + + C E RAP2.4a RAP2.6 D F4 MutA CE3 MutB MutC MutD MutE ABRE CE3: CTCCGGTCACGCGATTCAAC MutA:--------G----------- MutB:---------T---------- MutC:----------T--------- MutD:-----------T-------- MutE:------------T------- ABRE:******TACACGTGCA**** - + DNA - + - + - + - + - + - + shift

More Related