1 / 23

DNA Typing

DNA Typing. bsapp.com. bsapp.com. DNA strands come from the nucleus or the mitochondria. bsapp.com. DNA Strands. Building block of genetic makeup A complete copy of an individuals entire genome exist in nearly every cell Each persons genome is made up of billions of base pairs

bracha
Download Presentation

DNA Typing

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. DNA Typing bsapp.com

  2. bsapp.com

  3. DNA strands come from the nucleus or the mitochondria bsapp.com

  4. DNA Strands • Building block of genetic makeup • A complete copy of an individuals entire genome exist in nearly every cell • Each persons genome is made up of billions of base pairs • Most base pairs are “junk” DNA bsapp.com

  5. DNA is made up of chromosomes which contain matching genes called alleles bsapp.com

  6. Base pairs exist at the basic level of DNA bsapp.com

  7. Base Pairs • Adenine • Thymine • Guanine • Cytosine bsapp.com

  8. Variable Number Tandem Repeaters (VNTR) • Portions of DNA sequences are repeated • These repetitions vary among individuals CACATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATTGC bsapp.com

  9. Forensic DNA Testing • Only one-tenth of a percent of DNA differs from one human to the next • This still leaves millions of bases to analyze for differences bsapp.com

  10. Types of DNA Testing PCR (Polymorphism Chain Reaction) RFLP (Restriction Fragment Length Polymorphism) STR (Short Tandem Repeat) mtDNA (Mitochondrial DNA Analysis) bsapp.com

  11. PCR (Polymorphism Chain Reaction) • Doesn't accomplish DNA typing • Increases the amount of DNA available for typing by producing millions of copies • Use to amplify tiny quantities and degraded samples • Extremely sensitive to contamination bsapp.com

  12. Basic Procedure for Typing bsapp.com

  13. DNA is cut into different size VNTR’s by the use of restriction enzymes bsapp.com

  14. Fragments are placed on a gel plate bsapp.com

  15. Fragments are separated by electrophoresis bsapp.com

  16. The DNA is then transferred from the gel plate and made visible bsapp.com

  17. RFLP (Restriction Fragment Length Polymorphism) • Oldest/Cheapest test • Requires large amounts of non-degraded DNA • Utilizes the longer sequences of VNTR’s bsapp.com

  18. STR (Short Tandem Repeat) or SSR (Simple Sequence Repeats) • Used to evaluate specific regions (loci) of DNA strands • Utilizes shorter stands than VNTR’s • May by used on much smaller, older, and more degraded samples • Usually requires PCR prior to testing bsapp.com

  19. mtDNA(Mitochondrial DNA) • Uses DNA from a cellular organelle called a mitochondrion • Mitochondrial DNA degrades at a much slower rate than nuclear DNA • Allows analysis of older biological samples, such as hair and bones • Not as precise as STR • Extremely expensive and time consuming bsapp.com

  20. Reading DNA Tests bsapp.com

  21. bsapp.com

  22. bsapp.com

  23. bsapp.com

More Related