1 / 1

3’ LTR

A. B. Exon 2. Exon 1. 20-19. 21-5. SA (1767). SD (367). SP1. M. A. A. S. G. L. F. HBZ (SP1). AUG GCGGCCUCAG GGCUGUUU. SD (227). SA (1767). V. E. S. R. L. S. L. G. L. F. V. R. Q. S. T. S. R. -. HBZ (SP2). SP2.

brendan-simpson
Download Presentation

3’ LTR

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. A B Exon 2 Exon 1 20-19 21-5 SA (1767) SD (367) SP1 M A A S G L F HBZ (SP1) AUGGCGGCCUCAG GGCUGUUU SD (227) SA (1767) V E S R L S L G L F V R Q S T S R - HBZ (SP2) SP2 UGAACAAGCAGGGUCAGGCAAAGCGUGGAGAGCCGGCUGAGUCUAG GGCUGUUU M V N F V S V G L F HBZ (unspliced) HBZ AUGGUUAACUUUGUAUCUGUAG GGCUGUUU 3’ LTR 293T D C K30-3’/5681 C8166-45 M ACH K30 MJ Jas081 YB356 YB034 YB096 YB138 YB167 YB178 YB186 YB271 YB349 MT4 1P8 J1+ *

More Related