1 / 1

Genetic Manipulation and Competitive Interactions in Cellular Systems

This research study delves into the effects of induced PRDM9Cst and PRDM9Dom2, vector induction, and cold competition on HlxEsrPsmbPbx factors in cellular systems. Fraction shifts and competitor motifs were analyzed to understand genetic interactions.

brianna-hassett
Download Presentation

Genetic Manipulation and Competitive Interactions in Cellular Systems

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. A D Esrrg-1 Psmb9 34,315,351 189,902,535 34,317,991 189,905,108 E B Esrrg-1* (80 bp) + + + + + - + + Induced PRDM9Cst - + - + + + + - Induced PRDM9Dom2 - - + - - - - - Induced vector - - - - - - - + Cold competitor - - - HlxEsrPsmbPbx - Psmb9* (80 bp) + + + + + - + + Induced PRDM9Cst - + - + + + + - Induced PRDM9Dom2 - - + - - - - - Induced vector - - - - - - - + Cold competitor - - - HlxEsrPsmbPbx - Fraction shifted 0.0 0.53 0.02 0.02 0.03 0.03 0.31 0.03 Fraction shifted 0.0 0.38 0.02 0.02 0.02 0.08 0.34 0.03 F C Psmb9* (80 bp) + + + + + + + Induced PRDM9Cst + + + + + + + Competitor (bp) - 80 30r 28r 25r 32l 30l Esrrg-1* (80 bp) + + + + + Induced PRDM9Cst + + + + + Competitor (bp) - 80 30 33 36 Fraction shifted 0.40 0.08 0.25 0.12 0.12 Fraction shifted 0.50 0.09 0.27 0.28 0.53 0.16 0.19 G Esrrg-1(33 bp) - ATACTTTGCAAATATCAAGGCTCTAATACAAAT Psmb9 (30 bp) - Atccagggaatagaactttgaccattaccc Inferred motif

More Related