Blood study guide due next class!!!!!!!!!

1. Blood study guide due next class!!!!!!!!!

2. Do Now! • Write 1 thing you know about DNA on the board !

3. DNA Profiling

9. Identify or eliminate suspects • Exonerate wrongly accused • Identify victims of crimes or catastrophes • Establish paternity • Link crime scenes together

10. Paternity Cases 2. 1. • Who’s your daddy? 1. 2.

11. Exoneration • Kirk Bloodsworth • Convicted in 1985 for the rape and strangulation of a 9-year old girl and sent to death row • In 1992, defense attorneys were successful in having a dime-sized semen stain on the girl’s underpants tested against Bloodsworth’s DNA • He was exonerated

12. DNA Profiling • “I didn’t understand the DNA stuff at all. To me, it was just a waste of time. It was way out there and carried absolutely no weight with me at all.” • Post-trial commentary from a juror in the O.J. Simpson trial: V. Bugliosi, Outrage (New York: Dell Publishing, 1996). • “In a forensic setting, ... an innocent suspect has little to fear from DNA evidence, unless he or she has an evil twin.” • N. Risch & B. Devlin, “On the Probability of Matching DNA Fingerprints” (1992) 255 Science.

14. RFLPs • DNA is cut by molecular “scissors” – enzymes which recognize particular sequences of nucleotides • These enzymes identify short sequences of DNA, then snip it • Because everyone’s DNA is different, enzymes cut in different places • The resulting samples contain DNA fragments of different size (Restriction Fragment Length Polymorphisms)

15. RFLP: Gel Electrophoresis • DNA is visualized using electrophoresis • Negatively charged DNA moves through a gel with a current • Smaller DNA moves faster than larger DNA fragments

17. Results?

21. How unique are these profiles? • The probability of 2 people having exactly the same DNA profile is between 1 in 5 million to 1 in 100 billion (greater than the population of humans on earth) • This number becomes even larger if you consider more regions of DNA • Thus, the odds that the DNA evidence from a crime scene will match your DNA profile is astronomically small (unless you have an evil identical twin)

25. PCR allows us to use STRs • Short Tandem Repeats • Newer method than RFLPs • Faster • Uses 13 different primers to isolate the 13 different loci as identified by the FBI

28. For example, D7S280 is STR that repeats ‘GATA’ • CTAACGATAG ATAGATAGAT AGATAGATAGATAGATAGAT AGATAGATAG ATA • How many GATA’s? • So at this loci (location) the person’s # is _______

29. Narrowing it down • You can calculate the probability that two people would have same # of STR’s for EACH of the 13 loci…..it’s nearly impossible!

36. Case Study: The First Use of DNA Evidence • Two teenage girls raped and murdered in Leicestershire, England • Semen from the victims indicated a male with Type A blood and a rare enzyme = 10% of the local male population • A local boy, Richard Buckland, confesses upon interrogation • Police use DNA fingerprinting to confirm, but DNA profiles of Buckland and crime scene DNA do not match • Ironically, Buckland becomes the first person exonerated by DNA evidence

37. Case Study: The First Use of DNA Evidence • Police request DNA samples from all adult males in 3 nearby villages (5000 men) • 6 months later – no results! • A year later, police are informed by a bakery worker that they overheard a co-worker bragging they had given a DNA sample for another man • Police obtain DNA from Colin Pitchfork and obtain a perfect match

38. The Result? • In 1988, Colin Pitchfork was tried and convicted and sentenced to life in prison for the double rape and homicide based in large part to the DNA evidence

39. O.J. Simpson Trial-Discussion Q’s • What was the crime? • What was the evidence? • What was the defense team’s strategy? • What can future prosecution teams learn from this trial?