Bio-barcode Amplification meets Nanoarray: High throughput functional genomics and proteomics study in single cell lev

1. If I were a PDF in Dr Mirkin’s group Department of Chemistry and Institute for Nanotechnology, Northwestern University Bio-barcode Amplification meets Nanoarray: High throughput functional genomics and proteomics study in single cell level Student: Xu Zhang

2. Last ten years, our central task was sequencing. The Century of the Gene

3. ATGCCGATCGTACGACACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGATCCATTTTAATGCCGATCGTACGACACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGATCCATTTTA TACTGACTGCATCGTACTGACTGCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTTTACCCCATG CATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCAGCATCCATC CATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATGCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGG ACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTGACTGCATCGTACTGACTGCACATATCGTCATACATAGACT TCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATG ATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATA GCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTAC TGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCAT CGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTC ATCGTACTGACTGTCTAGTCTAAACACATCCCAGCATCCATCCATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTAT GCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCAT CGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACA TATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTAT GCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTAC TGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCAT CGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACA TATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATAGCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGA CTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACGCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGA CTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTT CGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGC ATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCAGCATCCATCC ATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATGCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGA CTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTC GTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGAT ATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACGC CGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTG A book of life: The secret of life is hidden here…

4. 人猿分手，屈指仅数百万年 However, very little difference between Mammalia species was found in genome sequence

5. In the post-genomic era The central task for biologists is to decipher the genome sequence ……a cat at a tag…….

6. Central dogma DNA mRNA Protein

7. Gene expression is conditional • Different tissues • Different cells • Different physiologic and pathologic states • Different development phases. So studying the conditional cell-specific gene expression in model organisms is the main area of interest.

8. The current techniques for genomics and proteomics • Genechip (DNA microarray, protein microarray) • MALDI-TOF Mass spectrometry • Polymerase Chain Reaction (PCR) based molecular biological methods • Molecular beacon technique However, all these methods are not applicable for parallel studying of gene expression in both mRNA and protein level for a single cell, which requires ultra sensitivity, specificity, massive multiplexing capability, and quantitative capability.

9. The objective of this projectDeveloping a high-throughput screening approach for genomics & proteomics study in single cell levelBased on: • Bio-barcode amplification • Aptamer sensing • Fluorescent dye-doped nanoparticle labeling • Gene Nanochip (DNA nanoarray).

10. The new system Includes: • Magnetic particles functionalized with aptamers for target separation • Gold nanoparticle (or polystyrene microparticles) functionalized with aptamers for target identification • DNA Nanochip system based on Dip-pen nanolithography and dye-doped nanoparticle probing or AFM scanning for detection Key words : High throughput(massive multiplexing screening) Ultra sensitivity(single molecule/cell detection)

11. What we have done • Bio-barcode Amplification assay for protein detection • Bio-barcode Amplification assay for DNA/RNA detection. • Scanometric Assay with silver amplification • Dip-pen Lithography (DPN) • Nanoarray fabricating based on DPN

12. Bio-barcode Amplification Strategy for Protein • Each Au nanosphere carries 300 barcode DNA strands, providing amplification. • Sensitivity: Coupled with scanometric assay: 30 aM (200 copies /10 ul sample) • Coupled with PCR assay: 3 aM (20 copies /10 ul sample)

13. Fluorophore based BCA Strategy for Protein A schematic of a fluorophore-based bio-barcode amplification assay. Sensitivity: by fluroscence detection: 7 pM Simplicity: eliminating scanometric assay, applicable for in situ detection. Time:90 min. Amplification: 102 times of original BCA because 4.3x104barcode DNA strands per polystyrene particle.

14. BCA Strategy for DNA & RNA Original BCA: Sensitivity: by scanometric assay, 300 zM(10 copies in 30µL sample ), comparable to PCR. Simplicity:need three distinct oligo strands on a single nanoparticle, which is synthetically demanding and costly, and limits its multiplexing capability. High temperature for barcode DNA release DTT based BCA: Sensitivity: by scanometric assay, 7 aM(60 copies in 10µL sample), less than PCR. Simplicity:just one kind thiolated oligo strands immobilized on a NP Quantitative capability: improved, the dynamic range is 7 aM- 7 fM DTT is used for barcode DNA release

15. Scanometric DNA detection • The probe strands are arrayed on a solid support and the detection strand is bound to an Au nanosphere. • The selectively assembled Au nanospheres then act as nucleation sites for Ag deposition upon the chemical reduction of Ag+ from solution. • The resulting Ag deposits can be quantified by a scanner (hence scanometric) • The scanometric assay provides ~4 orders of magnitude of sensitivity over the fluorescence • At the expense of array density and throughput.

16. Proposed Research 1Aptamer based nano/micro devices for massive separation and identification of DNA/RNA/Protein • Aptamers • synthesized single-stranded DNA or RNA oligo, 25–60 nucleotides in length • capable of binding to various biomolecules such as amino acids, drugs, proteins, and other biomolecules with high specificity. • screened from a randomly generated population of DNA/RNA sequences for their ability to bind with desired molecular targets (SELEX) • Aptamer can specifically recognize and bind any protein molecule and transforms protein’s structural information to its sequence information. • Aptamer rivals monoclonal antibody as molecular recognition moiety: • the hybridization conditions for aptamer- protein can be the same as DNA-DNA, while protein-protein hybridization is different from DNA-DNA’s • chemically synthesized, less deviation, less expenditure, easier for modification, and more thermally stable while mAB is produced by cells, more expensive, more variation, with no thermal stability, and difficult for modification.

17. Proposed Research 1Aptamer based nano/micro devices for massive separation and identification of DNA/RNA/Protein • Experimental work: • Using thiolated aptamers as the probes for Au NP functionalization • Immobilizing the aptamer strands onto the surface of the particles (magnetic and Au particles). Both directly covalent conjugation and biotin-avidin mediated coupling should be tried. • Optimizing the hybridization conditions for aptamer-protein reactions . • Testing the specificity and separation efficiency of the protein separation based on aptamer functionalized particles.

18. Proposed Research 2DNA Nanoarray based on Direct-Write DNP • Prepare the ink (DNA strands) • The paper (silicon slides) • Coat the cantilever with the ink • Scan the area for patterning in the contact mode. • Barcode DNA recognition. • Detect by fluorescence scanning with a scanner or by AFM • Advantages: High throughput and ultra sensitivity, free label screening (simplicity and massive multiplexing)

19. Proposed Research 2Nanoarray screening by AFM Height profiles of TM-AFM cab be used for screening. The most distinctive advantage is it suggests a label-free massive DNA screening technique. Moreover, its high sensitivity is also critical for the single cell detection.

20. Proposed Research 2Nanoarray screening based on dye-doped NPs Dye-doped silica NPs: • Uniform and controllable size (10-100 nm) • Highly fluorescent (104 dye molecules per NP) • Excellent signaling ability (104 dye molecules to signal a single hybridization event ), i.e., ultra sensitivity. • Highly photostable from photobleaching • No need AFM, and suitable for confocal scanning.

21. Proposed Research 3Application of the high throughput system for real gene expression study in single cell level • Tumor cell from breast tissue culture with and without the treatment of one kind of anti-cancer drug is chosen as the model organism • Breast cancer related genes and proteins are chosen for research • Screening the mRNA profile for a single cell, here, the condition is provided by the treatment of a special anticancer drug. • Screening the cancer related protein expression profile for the same cell • comparative study of the information obtained from these two sets of experiments for the understanding of the molecular mechanism for the tumor development and how the drug works in terms of the gene expression

22. Summary • This project utilizes bio-barcode amplification, aptamer sensing, dye-doped NPs labeling, nanofabricating by DPN, confocal scanning, and AFM for label-free DNA screening to develop a high throughput approach with ultra sensitivity for single molecule detection, and investigates its application in genomics and proteomics research. • All these unique techniques involved in this technology are with high sensitivity, specificity, simplicity, and quantitative capability, and can be easily integrated to form the high throughput methodology, which are promising for both fundamental research and clinical diagnosis.

23. Reference Nam, J. M.; Thaxton, C. S.; Mirkin, C. A. Science, 2003, 301, 1884-1886.  Nam, J. M.; Park, S. J.; Mirkin, C. A. J. Am. Chem. Soc.2002, 124, 3820-3821. Nam, J. M.; Stoeva, S. I.; Mirkin, C. A. J. Am. Chem. Soc.2004, 126, 5932-5933. Mirkin, C. A.; Letsinger, R. L.; Mucic, R. C.; Storhoff, J. J. Nature, 1996, 382, 607-609. Elghanian, R.; Storhoff, J. J.; Mucic, R. C.; Letsinger, R. L.; Mirkin, C. A. Science, 1997, 277, 1078-1080. Reynolds, R. A., III; Mirkin, C. A.; Letsinger, R. L. J. Am. Chem. Soc.2000, 122, 3795-3796. Park, S.-J.; Lazarides, A. A.; Storhoff, J. J.; Pesce, L.; Mirkin, C. A. J. Phys. Chem. B2004, 108, 12375-12380. Taton, T. A.; Mirkin, C. A.; Letsinger, R. L. Science,2000, 289, 1757-1760. Demers, L. M.; Mirkin, C. A.; Mucic, R. C.; Reynolds, R. A.; Letsinger, R. L.; Elghanian, R.; Viswanadham, G. Anal. Chem.2000, 72, 5535-5541. Oh, B. K, ; Nam, J. M.; Lee, S. W.; Small, 2006, 2, No.1, 103-108 Thaxton, C. S.; Hill, H. D.; Georganopoulou, D. G., Stoeva, S. I.; Mirkin, C. A.Anal. Chem.2005,77 (24), 8174 -8178. Ellington, A.; Szostak, J. W., Nature.1990, 346, 818–822 Robertson, D. L.; Joyce, G. F., , Nature,1990, 344, 467–468. Feigon, J., Dieckmann, T., and Smith, F. W. Chem. Biol. 1996, 3, 611-667 Zhao, X.; Rovelyn T. D.; Tan, W. J. Am. Chem. Soc. 2003, 125, 11474-11475 Ginger, D. S.; Zhang, H.; Mirkin, C. A. Angew. Chem., Int. Ed. 2004, 43, 30. Demers, L. M.; Ginger, D. S.; Park, S. J.; Li, Z.; Chung, S. W.; Mirkin, C. A. Science 2002, 296, 1836. Demers, L. M.; Park, S. J.; Taton, T. A.; Li, Z.; Mirkin, C. A. Angew. Chem., Int. Ed. 2001, 40, 3071 Lee, K.-B.; Park, S. J.; Mirkin, C. A.; Smith, J. C.; Mrksich, M. Science, 2002, 295, 1702. Lee, K.-B.; Lim, J.-H.; Mirkin, C. A. J. Am. Chem. Soc. 2003, 125, 5588. Lim, J.-H.; Ginger, D. S.; Lee, K. B.; Heo, J.; Nam, J-.M.; Mirkin, C. A. Angew. Chem., Int. Ed. 2003, 42, 2309. Nam, J.-M.; Han, S. W.; Lee, K. B.; Liu, X. G.; Ratner, M. A.; Mirkin, C. A. Angew. Chem., Int. Ed. 2004, 43, 1246.

24. Let’s explore the secrets within life Let’s enjoy the beauty of life sciences Let’s enjoy the beauty of our lives Thanks to Dr. Thomas, Thanks to all of you.