1 / 42

Prokaryotic Transcription

Prokaryotic Transcription. Nilansu Das Dept. of Microbiology Surendranath College. Paper III Group A: Cellular and Molecular Biology Unit I 1. DNA Replication: (10) DNA-Replication-Meselson-Stahl experiment as evidence for semiconservative

bucy
Download Presentation

Prokaryotic Transcription

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Prokaryotic Transcription Nilansu Das Dept. of Microbiology Surendranath College

  2. Paper III Group A: Cellular and Molecular Biology Unit I 1. DNA Replication: (10) DNA-Replication-Meselson-Stahl experiment as evidence for semiconservative replication; Mechanism of replication-Rolling-circle model & Theta (8) structure (bidirectional) 2. Transcription in prokaryotes: (15) Mechanisms (Initiation, elongation, termination); promoter structures, subunits of bacterial polymerases, functions and domains responsible for activity, elongationprocess, mechanism of termination, -dependent and independent termination; lac, trp, ara operons. 3. Mechanism of translation in prokaryotes: (15) Description of ribosomal cycle including phenomena of initiation, elongation, termination; description of factors involved in these processes; genetic code; tRNA: clover-leaf structure & function; rRNA: structure and function; role of aminoacyl tRNA synthetases. Non-ribosomal peptide synthesis: cyclic peptide antibiotics e.g. Gramicidin etc.

  3. Basic facts Transcription is the first stagein gene expression and the principal step at which it is controlled. Transcription itself is an autonomous activity of an enzyme, RNA Polymerase,which attaches to DNA at the start of a gene and then moves along, transcribing RNA. Genes are however not transcribed indiscriminately. Regulatory proteinsdetermine whether a particular gene will be transcribed or not.

  4. Transcription can be divided into 3 stages 1. INITIATION 2. ELONGATION 3. TERMINATION Initiation begins with the binding of RNA polymerase to the ds DNA. RNA synthesis starts denovo after local unwinding of the template DNA The initiation stage may be protracted by the occurrence of abortive initiation, when the enz makes short (2-9 bases) transcripts and aborts them.

  5. Initiation continued... The sequence in DNA required for initiation reaction is called promoter. The site at which the first nucleotide is incorpoated is called the startsite or startpoint The enzyme (RNAP) does not move during the initiation phase; it only shrinks from behind.

  6. Tanscription in Prokaryotes • Polymerization catalyzed by RNA polymerase • Can initiate synthesis • Uses rNTPs • Requires a template • Unwinds DNA • 4 stages • Recognition and binding • Initiation • Elongation • Termination and release

  7. Tanscription in Prokaryotes • 4 stages of Transcription • Recognition and binding • Initiation • Elongation • Termination and release

  8. Stages of Transcription • Template recognition • RNA pol binds to DNA • DNA unwound • Initiation • Elongation • RNA pol moves and synthesizes RNA • Unwound region moves • Termination • RNA pol reaches end • RNA pol and RNA released • DNA duplex reforms

  9. RNA Polymerase • 5 subunits, 449 kd (~1/2 size of DNA pol III) • Core enzyme • 2  subunits---hold enzyme together • --- links nucleotides together • ’---binds templates • ---recognition of promoter • Holoenzyme= Core + sigma

  10. RNA Polymerase Features • Starts at a promoter sequence, ends at termination signal • Proceeds in 5’ to 3’ direction • Forms a temporary DNA:RNA hybrid • Has complete processivity

  11. RNA Polymerase • X-ray studies reveal a “hand” • Core enzyme closed • Holoenzyme open • Suggested mechanism • NOTE: when sigma unattached, hand is closed • RNA polymerase stays on DNA until termination.

  12. A Simple Prokaryotic Gene

  13. Recognition • Template strand • Coding strand • Promoters • Binding sites for RNA pol on template strand • ~40 bp of specific sequences with a specific order and distance between them. • Core promoter elements for E. coli • -10 box (Pribnow box) • -35 box • Numbers refer to distance from transcription start site

  14. Template and Coding Strands Sense (+) strand DNA coding strand Non-template strand DNA template strand antisense (-) strand 5’–TCAGCTCGCTGCTAATGGCC–3’ 3’–AGTCGAGCGACGATTACCGG–5’ transcription 5’–UCAGCUCGCUGCUAAUGGCC–3’ RNA transcript

  15. The Promoter 5-9 bps 16-19 bps TTGACA TATAAT -35 hexamer Pribnow box A typical promoter has 3 components : consensus sequence at -35 consensus sequence at -10 startpoint

  16. E.coli sigma factors recognize promoters with different consensus sequences Gene Mass Use -35 seq Separation -10 seq rpoD 70K general TTGACA 16-18 bp TATAAT rpoH 32K Heat shock CNCTTGAA 13-15 bp CCCCATNT rpoN 54K nitrogen CTGGNA 6 bp TTGCA flaI (?) 28K flagellar TAAA 15 bp GCCGATAA

  17. Consensus sequences Typical Prokaryote Promoter • Pribnow box located at –10 (6-7bp) • -35 sequence ~(6bp) • Consensus sequences: Strongest promoters match consensus • Up mutation: mutation that makes promoter more like consensus • Down Mutation: virtually any mutation that alters a match with the consensus

  18. In Addition to Core Promoter Elements • UP (upstream promoter) elements • Ex. E. coli rRNA genes • Gene activator proteins • Facilitate recognition of weak promoter • E. coli can regulate gene expression in many ways

  19. Transcription Initiation • Steps • Formation of closed promoter (binary) complex • Formation of open promoter complex • Ternary complex (RNA, DNA, and enzyme), abortive initiation • Promoter clearance (elongation ternary complex) • First rnt becomes unpaired • Polymerase loses sigma • NusA binds • Ribonucleotides added to 3’ end

  20. Initiation of Transcription

  21. Holoenzyme • Core +  • Closed (Promoter) Binary Complex • Open binary complex • Ternary complex • Promoter clearance

  22. Sigma () Factor • Essential for recognition of promoter • Stimulates transcription • Combines with holoenzyme • “open hand” conformation • Positions enzyme over promoter • Does NOT stimulate elongation • Falls off after 4-9 nt incorporated • “Hand” closes

  23. Variation in Sigma • Variation in promoter sequence affects strength of promoter • Sigmas also show variability • Much less conserved than other RNA pol subunits • Several variants within a single cell. EX: • E. coli has 7 sigmas • B. subtilis has 10 sigmas • Different  respond to different promoters

  24. Sigma Variability in E. coli • Sigma70 (-35)TTGACA (-10)TATAAT • Primary sigma factor, or housekeeping sigma factor. • Sigma54 (-35)CTGGCAC (-10)TTGCA • alternative sigma factor involved in transcribing nitrogen-regulated genes (among others). • Sigma32 (-35)TNNCNCNCTTGAA (-10)CCCATNT • heat shock factor involved in activation of genes after heat shock. • POINT: gives E. coli flexibility in responding to different conditions

  25. Sigma and Phage SP01 • Early promoter—recognized by bacterial sigma factor. Transcription includes product, gp28. • gp28 recognizes a phage promoter for expression of mid-stage genes, including • gp33/34, which recognizes promoters for late gene expression.

  26. Promoter Clearance and Elongation • Occurs after 4- 10 nt are added • First rnt becomes unpaired from antisense (template) strand.DNA strands re-anneal • Polymerase loses sigma, sigma recycled • Result “Closed hand” surrounds DNA • NusA binds to core polymerase • As each nt added to 3’, another is melted from 5’, allowing DNA to re-anneal. • RNA pol/NusA complex stays on until termination. Rate=20-50nt/second.

  27. Open complex Abortive initiation Elongation

  28. An elongating complex may facepausingdepending on sequence and rNTP availability A paused complex may or may not undergo backtracking Elongation Elongatingcomplex

  29. Topo I Gyrase Restoration of superhelicity after transcription +ve supercoiled -ve supercoiled RNAP RNA Transcription may generate more tightly wound (positively supercoiled) DNA ahead of RNA polymerase, while the DNA behind becomes underwound (negatively supercoiled).

  30. The intrinsic terminator module consists of a stem-loop sequence followed by a run of Us in RNA UUUUUUUU-3’ 5’ Termination Intrinsic (Rho-independent) Rho-dependent

  31. Intrinsic Terminators • DNA template contains inverted repeats (G-C rich) • Can form hairpins • 6 to 8 A sequence on the DNA template that codes for U • Consequences of poly-U:poly-A stretch? Coding strand

  32. Intrinsic Termination • RNA pol passes over inverted repeats • Hairpins begin to form in the transcript • Poly-U:poly-A stretch melts • RNA pol and transcript fall off UUUUU

  33. Rho () Dependent Terminators • rho factor is ATP dependent DNA-RNA helicase • catalyses unwinding of RNA: DNA hybrid

  34. (17 bp) Rho Dependent Termination • rho factor is ATP dependent helicase • catalyzes unwinding of RNA: DNA hybrid • 50~90 nucleotides/sec

  35. Rho: Mechanism hexamer • Rho binds to transcript at  loading site (up stream of terminator) • Hairpin forms, pol stalls • Rho helicase releases transcript and causes termination

  36. Termination continued... UUUUUUUU-3’ A-U is the weakest hybrid 5’ Stem-loop formation removes the nascent RNA from ss binding region on the surface of RNAP

  37. UUUUUUUU-3’ 5’ Intrinsic Termination

  38. Rho-loading seq Rho-dependent Termination Rho protein binds as hexamers to a site in RNA called Rho-loading site. Rho then rapidly moves along the RNA towards RNAP Rho is a RNA-DNA helicase

  39. Rho-dependent Termination

  40. Thank You

More Related