How does DNA instruct cells to make PROTEINS?

1. How does DNA instruct cells to makePROTEINS?

2. Part IDNA, Genes, and Proteins

3. DNA and genes • Some stretches of DNA are called genes. • Genes are stretches of nucleotide bases (DNA) that code for proteins. • Proteins are used to build cells and do much of the work inside cells.

4. Genes and Proteins • Each gene code is copied in the nucleus and taken to the cytoplasm. • Here the code isdeciphered and converted into a string of aminoacids (a protein) • Each different protein has its own gene, somewhere on the chromosome, that codes for it.

5. Part IICOPYING THE GENE

6. DNA cannot leave the nucleus of eukaryotic cells... but proteins are made outside of the nucleus by organelles called ribosomes human cheek cell Elodea leaf cell mitochondria chloroplasts vacuole nucleus (DNA here) (DNA here)

7. Think of ribosomes as factories that make proteins ribosomes (proteins made here) (proteins made here) nucleus (DNA here) (DNA here)

8. ribosomes (proteins made here) DNA DNA and ribosomes are at different locations in a prokaryotic cell. Q. Ribosomes make protein but are not in the same location as DNA in a cell. How can proteins be made according to the DNA information when they are in different places?

9. A. Take a copy of the Gene to the ribosome. • mRNA transfers a copy of the gene on the DNA in the nucleus to the ribosomes. • Ribosomes build proteins according to the mRNA information received.

10. mRNA: the messenger RNA is how the body gets information from the nucleus (DNA) to the place where protein gets made (ribosomes)

11. Information flow from DNA to trait Observed trait DNA protein Made by ribosomes outside of nucleus Stored in nucleus

12. Information flow from DNA to trait messenger RNA Observed trait DNA protein Made by ribosomes outside of nucleus Stored in nucleus

13. DNA information  mRNA information messenger RNA Transcriptionis the process used to convert DNA information into mRNA information. DNA Note: DNA does not become RNA; the information in DNA is copied as RNA

14. Part IIIRNA (Ribonucleic acid)and Transcription

15. What is RNA, anyways?How is it different than DNA?

16. DNA Double strand Deoxyribose sugar Contains thymine (and A, G, & C) Very large molecule RNA Single strand Ribose sugar Contains uracil (and A, G, & C) Small molecule Differences between DNA and RNA

17. Different Sugars DNA RNA Can you spot the difference?

18. Different Bases Can you spot the difference?

19. RNA IS COPIED FROM DNA DNA (double stranded, kept “safe” in nucleus) Genes are Copied RNA (single stranded - mobile)

20. The Transcription process • Promoters are a specific set of bases on DNA that show where a gene begins. • For transcription to occur, the enzyme RNA polymerase binds to DNA at the promoter and separates the DNA strands • RNA Polymerase then uses one strand of DNA as a template to assemble nucleotides into a copy of the gene (mRNA)

21. The Transcription Process • Terminators! Are a specific set of bases to show where the gene ends. • RNA polymerase stops copying the gene here, moves off to find another gene, the transcript is released and the DNA “zips” back up.

22. Transcription of RNA from a template strand of DNA

23. Transcription DNA zips back together DNA unzips DNA ACTTTACGGCAT ACTTTACGGCATTGAAATGCCGTA ACTTTACGGCATTGAAATGCCGTA RNA copy made ACUUUACGGCAU TGAAATGCCGTA RNA ACUUUACGGCAU

24. If the DNA sequence is this: TACGAGTTACATAAAATGCTCAATGTATTT What is the sequence of the mRNA? (Use the bottom strand as the template for mRNA) UACGAGUUACAUAAA

25. Animation of Transcription • http://www.fed.cuhk.edu.hk/~johnson/teaching/genetics/animations/transcription.htm

26. Part IVDecoding the mRNA:What is the code?

27. The Genetic Code“The Problem” • Somehow we need to read the order of nucleotides on mRNA and have that tell us the order of amino acids within eachprotein • As there are 20 amino acids and only 4 different bases each nucleotide on its own cant specify the position of a different amino acid

28. The genetic code“The solution” • If a word can only be a single letter long how many words can there be in the English language? • If we can have two letters form a word how many words can we make now? (aa, ab, ac, ba, bb, bc, etc.) • If two nucleotides can code for an amino acid how many amino acids can we code for? • There are 64 possible ways to combine three nucleotides (43). More than enough to code for 20 amino acids.

29. The Codon • A codon is a set of three nucleotides on mRNA and designates an amino acid • There are 20 amino acids, but 64 possible codons • So each amino acid may have more than one codon thatcodes for it.

30. A Codon Chart • Decode by reading the first then second then third base. • Example: AUG codes for Methionine

31. Part IVTurning mRNA into protein:Translation

32. Introducing…. Another RNA molecule; the final player in our story… tRNA

33. Transfer RNA (tRNA) • An RNA molecule with attachment site at one end for an amino acid. • The opposite end has three nucleotide bases called the anticodon. • If there are 64 possible codons how many different tRNA molecules do you think there are?

34. amino acid attachment site U A C anticodon Transfer RNA Amino acid

35. Codons and Anticodons Amino Acid The 3 bases of an anticodon are complementary to the 3 bases of a codon tRNA anticodon UGA GCAAUCACUACGGCA codon

36. Translation • Translation is the process of of decoding the mRNA into a protein. • Ribosomes read mRNA three bases or 1 codon at a time and construct the proteins

37. mRNA A U G C U A C U U C G 1. A Ribosome binds to mRNA

38. aa2 aa1 2-tRNA 1-tRNA G A U U A C 2. The Ribosome helps the correct tRNA bind to mRNA anticodon A U G C U A C U U C G A hydrogen bonds codon mRNA

39. aa3 3-tRNA G A A The Ribosome then helps the next correct tRNA bind to mRNA and a peptide bond forms aa1 aa2 peptide bond 1-tRNA 2-tRNA U A C G A U A U G C U A C U U C G A mRNA

40. aa3 3-tRNA G A A aa1 4. All Change !! aa2 1-tRNA U A C (leaves) 2-tRNA G A U A U G C U A C U U C G A mRNA Ribosomes move over one codon

41. aa4 4-tRNA G C U 5. Etc. Etc. !! aa1 aa2 aa3 2-tRNA 3-tRNA G A U G A A A U G C U A C U U C G A A C U mRNA

42. aa4 4-tRNA G C U peptide bonds aa1 aa2 aa3 2-tRNA G A U (leaves) 3-tRNA G A A A U G C U A C U U C G A A C U mRNA Ribosomes move over one codon

43. peptide bonds aa1 aa2 aa4 aa3 3-tRNA 4-tRNA G A A G C U G C U A C U U C G A A C U mRNA

44. aa5 5-tRNA U G A aa1 aa2 aa3 aa4 3-tRNA G A A 4-tRNA G C U G C U A C U U C G A A C U mRNA Ribosomes move over one codon

45. aa5 aa4 aa199 aa200 aa3 primary structure of a protein aa2 aa1 terminator or stop codon 200-tRNA A C U C A U G U U U A G mRNA

46. aa5 aa4 aa3 aa2 aa199 aa1 aa200 End Product –The Protein! • The end products of protein synthesis is a primary structure of a protein • A sequence of amino acid bonded together by peptide bonds

47. start codon A U G G G C U C C A U C G G C G C A U A A mRNA codon 1 codon 2 codon 3 codon 4 codon 5 codon 6 codon 7 stop codon protein methionine glycine serine isoleucine glycine alanine A Protein aa2 aa3 aa4 aa5 aa6 aa1 peptide bonds A Gene (DNA)

48. THE END!!!