Brief introduction to UNIX

1. Brief introduction to UNIX A. Emerson CINECA, High Performance Systems

2. Contents • Using Unix commands • command syntax • Getting Started • Getting help, identity, logging out • Files and directories • Making, renaming, deleting and copying. • Examining file contents. • Further file handling • File compression and making archives. • File permissions • Miscellaneous • Jobs and processes • Editing with vi.

3. Unix commands - usage • Unix commands are normally used in the form: • <command> <one or more options> <arguments> • Where the options are generally included with the – sign. • Example ls -l –a /usr/local/bin/files Single letter options can usually be combined: ls -la /usr/local/bin/files

4. Unix commands - wildcards • If you want to do the command on multiple files you can use the * “wild card” character. • Examples $ mv *.pl programs/perl/ $ ls data/* • Be careful with rm (which does a delete) because there is no way to undo it.. rm *.* AARGH!

5. Getting Started • Command • man • Purpose • Gives you the manual page for a given command • Example $ man pwd pwd(1) NAME pwd - print working directory name SYNOPSIS pwd DESCRIPTION pwd prints the path name of the working (current) directory. pwd is both an explicit command (invoked as /usr/bin/pwd), as well as a builtin

6. Getting Started • Command • id • Purpose • Tells you your username (!) and what group you belong to. • Example $ id uid=50083(aem0) gid=30(cineca)

7. Getting Started • Command • exit (or ctrl-d) • Purpose • Logs you out from the system • Example $ exit

8. Files and directories • Command • mkdir • Purpose • Makes a directory • Common options • -p • creates all the sub-directories in a path if they don’t exist • Examples $ mkdir perl-programs $ mkdir –p 2003/jan/data

9. Files and directories • Command • cd • Purpose • Changes directory. With no arguments changes to home directory. • Examples $ cd my_data $ cd /usr/local/bin/programs $ cd

10. Files and directories • Command • mv • Purpose • Moves or renames a file or directory • Common options • -i • Asks confirmation before overwriting another file or directory • Examples $ mv first.pl perl-programs/jan $ mv blast.out blast.out.bak $ mv *.seq sequence-dir

11. Files and directories • Command • rm • Purpose • Deletes or renames a file • Common options • -i • Asks confirmation first • -r • deletes all sub-directories of a directory (VERY DANGEROUS) • Examples $ rm *.old $ rm –i blast.pl File blast.pl. Remove ? (yes/no)[no] :

12. Files and directories • Command • cp • Purpose • Makes a copy of a file or directory • Common options • -i • Asks confirmation first if overwriting another file • -r • copies all files of all sub-directories of a directory • Examples $ cp program.f90 program.f90.old $ cp blastdir/*.out . . means the current directory

13. Files and directories • Command • ls • Purpose • Lists files and directories • Common options • -t • sort by modification time • -l • long format, gives all details of the file (very useful) • -a • shows file beginning with. (not visible with just ls) $ ls –lt total 136 -rw-r--r-- 1 bioinf00 cineca 15678 May 20 2002 test.out -rw-r--r-- 1 bioinf00 cineca 2939 May 20 2002 test.bas -rw-r--r-- 1 bioinf00 cineca 53541 May 20 2002 prova.bas size in bytes

14. $ less fasta_1.seq >THC479287 CAGAACAGTAGCTAAGAGTCAAACCATGCGTTTGAGTCTCAGCTCTGCT CTCCACTTTACCTTTTGAAGGAGATCCGGACTACAAAGGAAAGGTCTTT CTAATTTTTATCTTTTTTTTTTTTTAAACAGGTGAAGGTGCCGAGCTAT AGAAATACAAAATAAAGATCACACATCAAGACTATCTACAAAAATTTAT AGAAGAAAAGCATGCATATCATTAAACAAATAAAATACTTTTTATCACA AGGAA fasta_1.seq (END) Files and directories • Command • more (traditional Unix), less (Linux) • Purpose • Allows you to view the contents of a file.

15. Files and directories • Command • head, tail • Purpose • Allows you to view the first lines of a file (head) or the last lines of a file (tail) • Common options • n • The number of lines to show. The default is 10. $ head -5 seq.fasta >THC479329 SWI/SNF complex 155 KDa subunit^^SWI/SNF complex 155 KDa subunit (BAF155)^^SWI/SNF related TTTTAGAATCCAGAAATGGTGTTCCATTTATTCACTGAAAAAGAGAGAG TTCATTCATTTTCTCCATTCTTGCCAAACTCCCTCCCCTCATTTTTTCC ACACTGAGAAACATGTTTGTACAAAAACCACATATTATTCCCCCCCCTC TGGCTGAATTACAGGAATAAAACCAGATCAAAGACATGAAAAGAAAAAG

16. Further file handling • Command • compress (standard UNIX), gzip (GNU version – faster) • uncompress, gunzip • Purpose • Compresses text files to save disk space • Common options • -v • verbose, gives % compression ratio $ ls -l MAG500 -rw-r--r-- 1 aem0 cineca 3249198 Jan 29 2002 MAG500 $ gzip –v MAG500 gzip -v MAG500 MAG500: 70.1% -- replaced with MAG500.gz $ $ ls –l MAG500.gz -rw-r--r-- 1 aem0 cineca 971325 Jan 29 2002 MAG500.gz

17. Making archives • Command • tar • Purpose • Creates an archive of files and directories. Many Unix software packages consist of a tree of sub-directories which can be difficult to transfer between different machines. tarcan be used to create a single archive file which when untarred re-creates the original directory structure • Common options • -c • creates an archive • -f • uses a file for the archive (you can also use CDs,tapes, etc) • -x • extracts file from an archive • -v • verbose – tells the user what tar is doing (RECOMMENDED)

18. Creating archives - Example • $ ls -F • blast/ • $ tar -cvf blast.tar blast • blast/ • blast/results/ • blast/input/ • blast/input/input1.dat • blast/input/input2.dat • blast/input/input3.dat • blast/data/ • blast/data/blast1.out • blast/data/blast2.out • blast/data/blast3.out • blast/data/blast4.out • blast/data/blast5.out • blast/data/data-old/blast-old.out • blast/data/blast0.out directory to archive name of archive file

19. Extracting archives - Example • $ cd new-dir • $ tar -xvf blast.tar • blast/ • blast/results/ • blast/input/ • blast/input/input1.dat • blast/input/input2.dat • blast/input/input3.dat • blast/data/ • blast/data/blast1.out • blast/data/blast2.out • blast/data/blast3.out • blast/data/blast4.out • blast/data/blast5.out • blast/data/data-old/ • blast/data/blast0.out Often gzip is combined with tar archives to give files like blast.tar.gz or blast.tgz Sometimes called tarballs.

20. - rwx r-- r-- File permissions • $ ls -l blast.tar • -rwxr--r-- 1 aem0 cineca 30720 Mar 13 10:47 blast.tar File permissions special owner group other r - read access w - write access (for a directory means files can be deleted in the directory, even if the files don’t have write access) x - executable (searchable for a directory) - permission not set

21. File permissions • Command • chmod • Purpose • Changes the permissions of a file or directory. Only the owner of a file, or root, can change the permissions. • Common options • -R • changes all the permissions in a directory, including sub-directories $ chmod u+x myprog.pl $ chmod g+w,o-w seq.dat $ chmod +r *.fasta $ chmod 777 *.prog make file executable for owner write access for group, no write for others add read access for all octal notation, here = +rwx for all

22. Running programs • To run a program which is an executable file, just type the name of the file: $ my_prog.pl • However, like this the terminal cannot be used until the program finishes. Add an & to return control to the user (running in the background): $ my_prog.pl & [1] 31705 • Now the user can do other things, logout and go home, etc. • Note that Unix assigns a job number and a process number to the running program.

23. Running programs • To see what programs are running you can use the jobs command: $ jobs [1] + Running myprog.pl • But this only applies to programs run during the same session (the same shell). To see all programs (processes) being run use the ps command: $ ps –u aem0 31705 pts/3 00:00:40 myprog.pl 29775 pts/3 00:00:00 tcsh 31738 pts/3 00:00:00 ps

24. Editing with vi • vi is the standard Unix text editor and is present on every Unix system. $ vi myprog.pl • vihas 3 modes: • Command mode • For manipulating and moving through the the text • Line mode • For special commands and interacting with Unix. • Insert mode • For entering text, i.e. writing programs, entering data, etc.

25. Editing with vi • Command mode – the usual and initial mode (i.e. when starting vi) • Commands include • ←↑↓→ arrow keys move the cursor • hjkl same as arrow keys • x delete a character • dw delete a word • dd delete a line • 3dd delete 3 lines • u undo previous change • ZZ exit vi, saving changes

26. Editing with vi • Line mode – entered by typing :, / , ? or ! . • Commands include • :q! save file, discarding changes • :q quit • :e filename edit a new file • :w filename write with new filename • :wq write file and quit • :!cmd run Unix command • /string look for string RETURN executes command and returns to command mode

27. Editing with vi • Insert mode – entered by typing any of the following in command mode • a append after cursor • i insert before cursor • o open line below • O open line above • Rtext replace with text to exit insert mode, and return to command mode, type <ESC>.