1 / 36

BI420 – Course information

BI420 – Course information. Web site: http://bioinformatics.bc.edu/~marth/BI420. Instructor: Gabor Marth. Teaching assistant: Aaron Quinlan. BI420 – Material. Lectures (PowerPoints posted on web site). Text. BI420 – Discovery questions. http://www.aw-bc.com/geneticsplace/.

Download Presentation

BI420 – Course information

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. BI420 – Course information Web site: http://bioinformatics.bc.edu/~marth/BI420 Instructor: Gabor Marth Teaching assistant: Aaron Quinlan

  2. BI420 – Material Lectures (PowerPoints posted on web site) Text

  3. BI420 – Discovery questions http://www.aw-bc.com/geneticsplace/

  4. BI420 – Discovery questions Page 36, Discovery question #1.

  5. BI420 – Discovery questions GGGCTCAGCTGTATCAGCCACGTGCCTACAACAATCTGCCCCT

  6. BI420 – Discovery questions

  7. BI420 – Discovery questions

  8. BI420 – Introduction to Bioinformatics Genome organization and Bioinformatics Gabor T. Marth Department of Biology, Boston College marth@bc.edu

  9. The animal cell

  10. DNA – the carrier of the genetic code

  11. DNA organization – chromosomes

  12. DNA organization – mitochondria

  13. Translation of genetic information

  14. Gene organization

  15. mRNA splicing – alternative splicing

  16. Gene expression

  17. Protein structure

  18. RNA structure

  19. DNA evolution

  20. Mechanisms of molecular evolution

  21. Evolution of chromosome organization

  22. Evolution of gene structure

  23. Evolution of DNA sequence

  24. Genetic variations

  25. 1. The informatics of DNA sequencing DNA sequencing informatics

  26. 2. Gene prediction, genome annotation

  27. look at multiple sequences from the same genome region • use base quality values to decide if mismatches are true polymorphisms or sequencing errors 3. Polymorphism discovery and analysis

  28. 4. Gene/DNA expression analysis

  29. 5. Proteomics

  30. 6. Storage/retrieval of Biological data

  31. 7. Sequence alignment/similarity search

  32. 8. Phylogenetics

  33. 9. Evolutionary Genomics

  34. 10. Medical Genomics

  35. 11. Practical Bioinformatics using LINUX programming in PERL

  36. 12. Practical Bioinformatics CLONE id name received masked 1 NH0260K08 12-25-99 12-26-99 2 NH0407F02 12-28-99 01-03-00 HIT id cloneID hspID start end 1 1 1 1 17957 2 2 1 96912 114891 ALLELE id hitID nucleotide 1 1 C 2 2 T using and building databases

More Related