Secondary Structure Prediction (Mostly RNA)

Nov 09, 2014

90 likes | 228 Views

Secondary Structure Prediction (Mostly RNA). An example of RNA structure. RNA secondary structures. A real example - tRNA. Conserved structures. Building a grammar. An example grammar. Grammar for a protein motif. Example Hidden Markov Models.

Share Presentation

Embed Code

Link

rna
rna structure
conserved structures
protein motif
rna secondary structures
secondary structure prediction

ciaran-fry

Download Presentation

Secondary Structure Prediction (Mostly RNA)

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

SecondaryStructure Prediction(Mostly RNA)
An example of RNA structure
RNA secondary structures
A real example - tRNA
Conserved structures
Building a grammar
An example grammar
Grammar for a protein motif
Example Hidden Markov Models

RNA Secondary Structure

RNA Secondary Structure. RNA Structure Prediction. FoldRNA Various graphic display options MFold PlotFold StemLoop. Structural Prediction Limitations. Gunnar von Heijne 1987

926 views • 59 slides

RNA secondary structure prediction and runtime optimization

RNA secondary structure prediction and runtime optimization. Greg Goldgof October 5, 2006 CS374 Presentation Stanford University. Presentation Overview. CONTRAfold: probabilistic RNA folding. Background on RNA secondary structure prediction.

742 views • 45 slides

RNA Secondary Structure Prediction

RNA Secondary Structure Prediction. 16s rRNA. RNA Secondary Structure. Pseudoknot. Dangling end. Single- Stranded. Interior Loop. Bulge. Junction (Multiloop). Stem. Hairpin loop. Image– Wuchty. RNA secondary structure. G A A A G G A-U U-G C-G

659 views • 16 slides

Computational Prediction of RNA and DNA Secondary Structure

Computational Prediction of RNA and DNA Secondary Structure. Anne Condon Bioinformatics, and Empirical and Theoretical Algorithmics (BETA) Laboratory The Department of Computer Science, UBC. RNA plays varied roles in the cell….

718 views • 46 slides

RNA Secondary Structure Prediction

RNA Secondary Structure Prediction. Lecture 11: June 13, 2006 Algorithms of Molecular Biology. Introduction to RNA Sequence/Structure Analysis. RNAs have many structural and functional uses Translation Transcription RNA splicing RNA processing and editing cellular localization catalysis.

1.22k views • 84 slides

RNA Secondary Structure Prediction

RNA Secondary Structure Prediction. Dynamic Programming Approaches Sarah Aerni. http://www.tbi.univie.ac.at/. RNA folding Dynamic programming for RNA secondary structure prediction Covariance model for RNA structure prediction. Outline. RNA Basics. 3 Hydrogen Bonds – more stable.

1.44k views • 22 slides

RNA Secondary Structure Prediction

RNA Secondary Structure Prediction. RNA is a single-stranded chain of the nucleotides A, C, G, and U. The string of nucleotides specifies the linear structure of the RNA strand. When RNA folds, complementary nucleotides form base pairs (CG and AU).

913 views • 36 slides

RNA Secondary Structure

RNA Secondary Structure. aagacuucggaucuggcgacaccc uacacuucggaugacaccaaagug aggucuucggcacgggcaccauuc ccaacuucggauuuugcuaccaua aagccuucggagcgggcguaacuc. Hairpin Loops. Interior loops. Stems. Multi-branched loop. Bulge loop. A Context Free Grammar. S  AB Nonterminals: S, A, B

514 views • 33 slides

RNA Structure Prediction

RNA Structure Prediction. Chapter 16. Primary, Secondary and Tertiary Structures. RNA Structures. Ab Initio. Prediction based on a single RNA sequence Search for RNA structure with lowest energy Free energy calculated from G-C < A-U < G-U < unpaired pairs

857 views • 27 slides

RNA Structure Prediction

RNA Structure Prediction. RNA Structure Basics The RNA ‘Rules’ Programs and Predictions. Assigned reading: Ch. 6 from Bioinformatics: A Practical Guide to the Analysis of Genes and Proteins, 3rd Ed. by Baxevanis and Ouellette. BIO520 Bioinformatics Jim Lund. mRNA - messenger RNA.

578 views • 30 slides

RNA Secondary Structure

RNA Secondary Structure. aagacuucggaucuggcgacaccc uacacuucggaugacaccaaagug aggucuucggcacgggcaccauuc ccaacuucggauuuugcuaccaua aagccuucggagcgggcguaacuc. RNA and Translation. RNA and Splicing. Hairpin Loops. Interior loops. Stems. Multi-branched loop. Bulge loop.

531 views • 37 slides

Prediction of Secondary Structure of RNA

Prediction of Secondary Structure of RNA. Swetha Nandyala. Overview. Introduction How RNA Secondary Structure is obtained ? Various types of loops possible in RNA Secondary Structure Motivation Resource Implements the Algorithms to be Understood Algorithm Nussinovs RNA Folding Example.

488 views • 18 slides

Chapter 6 The Secondary Structure Prediction of RNA

Chapter 6 The Secondary Structure Prediction of RNA. Outline. Secondary Structure of RNA The RNA Maximum Base Pair Matching Algorithm Loop Dependent Free Energy Rules Minimum Free Energy Algorithm. Secondary Structure of RNA.

594 views • 40 slides

RNA secondary structure prediction

Doug Raiford Lesson 7. RNA secondary structure prediction. Why do we care. RNA World Hypothesis RNA world evolved into the DNA and protein world DNA advantage: greater chemical stability Protein advantage: more flexible and efficient enzymes ( biomolecules that catalyze)

645 views • 28 slides

RNA Secondary Structure Prediction

RNA Secondary Structure Prediction. Spring 2010. Objectives. Can we predict the structure of an RNA? Can we predict the structure of a protein?. RNA: Hypothesis and exclusions. Single stranded chain A RNA molecule is a string of n characters R=r 1 r 2 …r n such that r i  {A,C,G,U}

503 views • 32 slides

RNA: Secondary Structure Prediction and Analysis

RNA: Secondary Structure Prediction and Analysis. Outline. RNA Folding Dynamic Programming for RNA Secondary Structure Prediction Covariance Model for RNA Structure Prediction Small RNAs: Identification and Analysis. Section 1: RNA Folding. RNA bases: A,C,G,U Canonical Base Pairs A-U

1.61k views • 94 slides

molecule's structure prediction

molecule's structure prediction. RNA RNA folding Dynamic programming for RNA secondary structure prediction Protein Secondary Structure Prediction Homology Modeling Protein Threading ab-initio. Outline. RNA Basics. 3 Hydrogen Bonds – more stable. 2 Hydrogen Bonds. RNA bases A,C,G,U

638 views • 45 slides

Primary structure Secondary structure

13.1 RNA Consisting of a Single Strand of Ribonucleotides Participates in a Variety of Cellular Functions. The Structure of RNA. Primary structure Secondary structure. Classes of RNA. Ribosomal RNA – rRNA Messenger RNA – mRNA Transfer RNA – tRNA Small nuclear RNAs – snRNAs

614 views • 42 slides

RNA Structure Prediction

RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction. Rfam. Different search modes. http://rfam.sanger.ac.uk/. Browse Rfam. :RibosomalRNA :Small RNA (mainly bacterial) :Generally repressors of mRNA.

687 views • 21 slides

RNA Secondary Structure

RNA Secondary Structure. What is RNA? Definition of RNA secondary Structure RNA molecule evolution Algorithms for base pair maximisation Chomsky’s Linguistic Hierarchy Stochastic Context Free Grammars & Evolution Miscelaneous topics. Base Pairing From Przytycka. An Example: t-RNA.

465 views • 40 slides

Primary structure Secondary structure

488 views • 42 slides

RNA Secondary Structure Prediction

RNA Secondary Structure Prediction. Dynamic Programming Approaches Sarah Aerni. http://www.tbi.univie.ac.at/. RNA folding Dynamic programming for RNA secondary structure prediction. Outline. RNA Basics. RNA bases A,C,G,U Canonical Base Pairs A-U G-C

501 views • 16 slides

More Related