Rapid taxonomic classification of complex consortia of environmental rDNA using a microarray.

1. Rapid taxonomic classification of complex consortia of environmental rDNA using a microarray. What bugs are in my sample? CEB - ESD - LBNL Todd DeSantis, Sonya Murray, Jordan Moberg, Gary Andersen Carol Stone (DSTL, U.K.)

2. The ponderings of a toddler Why must Mom confiscate my “Hello Kitty” blanket on laundry day? Will the swings be wet at the park? How will this sausage impact the diversity in my lower G.I. bacterial community? Will I inhale any archaeal microorganisms when I visit the hot springs? Gianna DeSantis

3. Every discarded water sample, geological core, or spent air filter is lost data. • But who wants to do all the work? • Culture? Anaerobes? non-cultivable? Safety? • Analysis of nucleic acids isolated from environment • Must classify or sort heterogeneous nucleic acids into bins. • Restriction Fragment Length Polymorphisms (RFLP) • Single Stranded Conformation Polymorphisms (SSCP) • Temp/Denat Gradient Gel Electrophoresis (T/DGGE) • Sequencing • Provides taxonomic nomenclature • estimates the relative abundance • Need to create, clone, & process hundreds of samples • Can we create a simple, comprehensive (quantitative?) microbial test?

4. Project Overview • Goal • Create a single microarray capable of detecting and categorizing the bacteria in a complex sample. • Approach • GeneChip targeted at 16S rDNA sequence variations to distinguish taxa.

5. The Ribosome rDNA rRNA (functional molecule) LSU SSU 16s or 18s

6. Foundations: • Maintain the largest 16S gene library (~83,000). • Cluster sequences into taxa (~8,000). • Create algorithm for picking probes for each taxa (~500,000).

7. Build custom Affymetrix GeneChip • Massive parallelism – up to 2 million probes upon a 1.28 cm2 glass surface. • Identification of multiple species in a mixed population • Pair each probe with a “mismatch” control probe. cctagcatgCattctgcata cctagcatgGattctgcata MATCH MISMATCH

8. General Protocol Air Soil Feces Blood Water gDNA Universal 16S rDNA PCR rRNA Contains probes adhered to glass surface in grid pattern.

9. Overview of Sample Preparation using a Modified Affymetrix Protocol A C G G T C G A A C G G T C G A A C G G T C G A A C G G T C G A A C G G T C G A Extract Genomic DNA PCR Amplify DNA 18 µ Fractionate DNA 18 µ End-label with biotin Hybridize

10. Progress in Miniaturization 16S Microarray GeneChip 3000 scanner

11. 500,000 Probe 16S array (DOE 16S Chip)

12. Parameter Frankia Clostridium Positive fraction 1.00 0.64 Average difference 3720 625 PM MM Frankia sp. str. G48 Clostridium butyricum

13. High confidence bacterial species detection with 500K probe microarray: - Greater microbial diversity in EPA samples BASIS EPA (127 OTUs displayed)

14. C. perfringens probe set identified in EPA sample 22 (N.Y.C., Spring) C.AURANTIBUTYRICUM CFB C.THERMOBUTYRICUM_SUBGROUP C. BUTYRICUM Cyan High G+C C.ALGIDICARNIS Proteo Bacteria C.BOTULINUM_SUBGROUP C.CADAVERIS Bacil-Strep Gram + C.PERFRINGENS C.BARATI_SUBGROUP Clostridium 1492 27 16S rDNA 420 469 5 6 7 8 ...CGTAAAGCTCTGTCTTTGGGGAAGATAATGACGGTACCCAAGGAGGAAGCCACGGCTAACT... C. perf. str.CPN50 ................................................................... C. perf. resistant ................................................................... Clostridium sp. AB&J ................................................................... clone p-4636-2Wa2 ................................................................... C. perf. A ................................................................... C. perf rrnA ................................................................... C. perf rrnE .................................T................................. C. perf rrnD ................................................................... C. perf rrnC ................................................................... C. perf rrnB ................................................................... C. perf rrnF ................................................................... C. perf rrnG ................................................................... C. perf str.13a ................................................................... C. perf str.13b ................................................................... C. perf rrnH ................................................................... C. perf rrnI ................................................................... C. perf rrnJ ................................................................... clone OI1612 ................................................................... C. perf. B ................................................................... Swine manure 37-3 ................................................................... Swine manure 37-4 TAAAGCTCTGTCTTTGGGGAAGATA tacccaaggaggaagccacggctaa AAAGCTCTGTCTTTGGGGAAGATAA AAGCTCTGTCTTTGGGGAAGATAAT AGCTCTGTCTTTGGGGAAGATAATG Ave Diff =1891 Probes 5 - 8

15. -- ARCHAEA (1)---- EURYARCHAEOTA (1.1)------ METHANOMICROBACTERIA_AND_RELATIVES (1.1.3)-------- HALOPHILIC_ARCHAEA (1.1.3.4)---------- NTC.AMYLOLYTICUS_SUBGROUP (1.1.3.4.6) (Natronococcus) 1.1.3.4.6.32228 OTU 6 seqs prokMSA_id:649 AB012049 str. MSP1 prokMSA_id:650 AB012052 str. MSP11 prokMSA_id:653 AB012055 str. MSP16 prokMSA_id:654 AB012056 str. MSP17 prokMSA_id:655 AB012057 str. MSP22 prokMSA_id:656 AB012058 str. MSP23 Developing Microarray Experiment Browser

16. Clean Filter -extracted -amplified -fragmented -labeled -hybridized Example of detection with the -proteobacteria Sub-division Many of the detected taxa also contain "Environmental clone” members. 434 -proteobacteria taxa What’s in a “blank” sample? 2250306000000.030_st Acidobacterium capsulatum+ 2280208040000.041_st Bordetella pertussis+ 2280209041300.025_st Acidovorax avenae+ 2280210040000.040_st Burkholderia graminis+ 2280210060000.007_st Burkholderia cepacia+ 2280211000000.071_st Oxalobacter formigenes+ 2280299000000.001_st Ralstonia solanacearum+ 2280308990000.001_st Stenotrophomonas maltophilia+

17. Testing the effects of variation in hybridization temperatureAll 3 conditions allowed spikes to be detected.48deg hybridization permitted the least additional taxa to be reported. Create synthetic community of 16S amplicons. A. capsulatum Y. pestis C. jejuni S. aureus B. anthracis S. typhi B. melitensis R. prowazekii B. subtilis E. coli Separately culture, gDNA-extract, and PCR-amplify. Combine PCR products.

18. Testing the effects of variation in hybridization temperatureAll 3 conditions allowed spikes to be detected.48deg hybridization permitted the least additional taxa to be reported.

19. Reproducibility  Probes for C. jejuni tiled in 4 areas

20. Columbus, OH

21. Quantitative Considerations • Spike environmental samples with defined amplicons. • Calibrate • - Pearson’s corr coefficient was significant (df=18). • - 95% confidence intervals plotted.

22. Conf Interval: Conc(t(RSE)/b)(1/m+1/n+((Y-y)2)/ (b2(n-1)sx2)) b = slope from regression Y = mean of 6 replicate measurements m = number of repeat measurements = 6 y = mean of the HybScores for the 20 points used for calibration t = critical value obtained from t-table for 18 d.f. for 95% = 1.734 RSE = residual standard error of calibration points = 0.56 sx = standard deviation of the conc. for the 20 points used for calibration Environmental community is measured with confidence intervals.

23. Current projects • Netherlands soil bioremediation tracking • BioWatch – DHS metropolitan air microbe survey • G.I. community comparison • Root-soil interface • Does polymerase brand affect perceived community?

24. PCR Enzyme Comparison Takara PCR Biowatch gDNA + neg Applied Bio PCR + Biowatch gDNA neg

25. Summary The rDNA microarray is able to rapidly quantify and taxonomically classify complex consortia of rDNA amplicons. You can collect data on over 8,000 taxa simultaneously.

26. Acknowledgements • Gary Andersen – Group Leader • Carol Stone – UK sample collection, hybridization • Sonya Murray – sample preparation, hybridizations, manuscript composition • Jordan Moberg – sample preparation, sample tracking database, parameter optimization.