1 / 44

DNA – The Code of Life Chapter 12

DNA – The Code of Life Chapter 12. DNA – deoxyribonucleic acid. Functions of DNA: 1. to store and use information to direct the activity’s of the cell 2. to copy itself exactly in order to form new cells

colleen-sparks
Download Presentation

DNA – The Code of Life Chapter 12

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. DNA – The Code of LifeChapter 12

  2. DNA – deoxyribonucleic acid Functions of DNA: 1. to store and use information to direct the activity’s of the cell 2. to copy itself exactly in order to form new cells 3. must be able to pass copies of their DNA to offspring in order to keep species from going extinct

  3. DNA Nucleotides • Made of 3 parts: 1.phosphate molecule 2. sugar molecule – deoxyribose 3. nitrogen base – can be 1 of the 4 below: - adenine - thymine - cytosine - guanine **sugar & phosphate molecules are ALWAYS THE SAME IN EVERY NUCLEOTIDE

  4. Section 12-1 DNA Nucleotides Adenine Guanine Thymine Cytosine Phosphate group Deoxyribose Go to Section:

  5. Double Helix (Watson & Crick Model) • DNA molecule made of - 2 strands of nucleotides held by hydrogen bonds - looks like a twisted ladder • Sides of ladder = sugars & phosphates • Steps of ladder = pairs of nitrogen bases

  6. Structure of DNA Section 12-1 Nucleotide Hydrogen bonds Sugar-phosphate backbone Key Adenine (A) Thymine (T) Cytosine (C) Guanine (G) Go to Section:

  7. Complementary Pairs • Each base of DNA has a complementary pair: ADENINE BONDS WITH THYMINE A – T CYTOSINE BONDS WITH GUANINE C – G • Sequence of pairs are inherited by parents • Holds all info to determine the structure & function of an organism - color of hair, eyes, & skin - whether you are short or tall; if you are athletic or musically talented

  8. Warm up 4-24 • What makes up a nucleotide? • List the functions of DNA? • Name the 4 nitrogen bases and pair them up with their complementary pair. • Use the following sequence of bases to construct a DNA molecule: ATCGGCCTT

  9. Structure of DNA Quiz • What is a nucleotide? • Name the 4 nitrogen bases and show which ones are always paired together? • How many hydrogen bonds are between each pair of nitrogen bases? • What is the name of the sugar found in DNA? • What does DNA stand for? • Construct a DNA molecule using the sequence below… ACCGTTAAGGATCGA

  10. Replication of DNA • The process of making new DNA strands from an existing one ORIGINAL DNA ORIGINAL NEW A-T A- -T A-T A-T T-A T- -A T-A T-A C-G UNZIPS C- -G C-G C-G C-G C- -G  C-G C-G G-C G- -C G-C G-C T-A T- -A T-A T-A

  11. Process of Replication • DNA Helicase (enzyme) attaches to DNA • Helicase “unzips” the 2 strands - breaking the hydrogen bonds 3. Freely floating nitrogen bases bind with exposed nitrogen bases 4. DNA Polymerase forms the bonds of the newly formed strand & original strand RESULT = 2 DNA Molecules – 1 NEW & 1 OLD

  12. Replication

  13. DNA Replication (continue) • Sequence of nucleotides in each new strand EXACTLY MATCH that of the original molecule • Replication occurs simultaneously at many points on the molecule • Parts of DNA are copied at different times • DNA molecule is never copied all at once

  14. Accuracy & Repair • Replication is very ACCURATE • Cells have built-in “SPELL CHECK” to ensure no errors with the matching of pairs • Cells can also REPAIR itself • Enzymes recognizes & removes damaged nucleotides & replaces them with new ones • This ensures accuracy of replication

  15. Warm Up 4/25 • Turn to page 299 in text • Answer questions 1-5 • Write out questions and answers on a separate piece of paper • Warm up due at 12:25

  16. Discovering DNA Quiz • Which bases combine together in a DNA molecule? • Define a nucleotide. • Where do the nucleotides come from during DNA replication? • What are proteins made up of? • What organelle manufactures protein?

  17. RNA – Ribonucleic acid • DNA – stores & transports the info needed to make proteins - instructions only • RNA – uses the info (instructions) from DNA to make the proteins

  18. DNA vs. RNA

  19. Nucleotides of RNA Each RNA nucleotide includes: 1. phosphate group 2. sugar molecule – Ribose 3. 1 of 4 nitrogen bases: adenine uracil cytosine guanine

  20. Warm up 4-26 • Write Word of the Day in notebook • Complete review worksheet – section 12-2

  21. DNA vs. RNA Quiz 4-26 List 3 of the 4 differences between DNA and RNA. - you can answer using a table - If you can list all 4 ….. - you will earn 5 extra credit points

  22. Messenger RNA Ribosomal RNA Transfer RNA Types of RNA – Concept Map Section 12-3 RNA can be also called which functions to also called which functions to also called which functions to from to to make up Go to Section:

  23. Messenger RNA Ribosomal RNA Transfer RNA Bringamino acids toribosome Combine with proteins tRNA mRNA Carry instructions rRNA Rest of cell Ribosomes Types of RNA – Concept Map Section 12-3 RNA can be also called which functions to also called which functions to also called which functions to from to to make up nucleus Go to Section:

  24. Transcription –when RNA is made from DNA DNA RNA polymerase RNA nucleotides New RNA separates DNA attach to DNA molecule is made and detaches A-T A T A-U U C-G C G C-G G T-A T A T-A A G-C G C G-C C A-T A T A-U U A-T A T A-U U

  25. Transcription (cont.) • All types of RNA are formed this way • After RNA is made in the nucleus, it moves into the cytoplasm • In the cytoplasm, RNA is involved in the synthesis (making) of proteins

  26. Protein Synthesis • 3 mRNA nitrogen bases = CODON • 1 CODON = 1 AMINO ACID example – AUC = isoleucine • 3 tRNA nitrogen bases = ANTICODON - complementary pair to a CODON example : mRNA = AUC (codon) tRNA = UAG (anticodon) • 20 amino acids are made from 64 possible codons • This means that 1 amino acid can have more than one codon that codes for it

  27. THE GENETIC CODE

  28. TRANSLATION • assembling proteins from information encoded in mRNA. • Process: 1. mRNA moves out of nucleus by passing through the nuclear pores. 2. mRNA migrates to a group of ribosomes where tRNA begins to “translate” the CODONS of mRNA and makes ANTICODONS (complementary pair of a codon) 3. the ribosomes start to attach tRNA and amino acids together 4. the process continue until the POLYPEPTIDE (protein molecule) is complete Result = new POLYPEPTIDES are made Begin with DNA >>> mRNA >>> end with tRNA

  29. How Translation Works DNAuse left side of mRNA tRNA DNA to make (codon) (anticodon) mRNA A-T A-U U A G-C G-C C G A-T A-U U A (amino acid) REMEMBER ONLY 1 SIDE OF DNA IS USED TO START TRANSLATION

  30. MUTATIONS • Changes in the genetic material • Occurs when: 1. cells make mistakes in copying DNA. 2. inserting a wrong base 3. skipping a base as a new strand is put together

  31. Kinds of Mutations • Gene Mutations – mutations of a single gene 1. Point Mutations – involve changes in 1 or few nucleotides - occur at a single point in the DNA sequence A. Substitutions – one base is changed to another - affects only a single amino acid DNA TAC GCA DNA TAC GTA mRNA AUG CGU >>>> mRNA AUG CAU Amino acid MetArgAmino acid MetHis

  32. Gene Mutations (cont.) 2. Frameshift Mutations: - shifts the “reading” frame of the genetic code a. Insertion – adding an extra base DNA TAC GCA TGG AAT mRNA AUG CGU ACC UUA Amino acids Met – Arg – Thr – Leu ↓ Insertion DNA TAT CGC ATG GAA T mRNA AUA GCG UAC CUU A Amino acid Ile – Ala – Tyr – Leu

  33. Gene Mutations (cont.) b. Deletion: removing a base THE FAT CAT ATE THE RAT If H is deleted in THE, the sentence would read TEF ATC ATA TET HER AT

  34. Gene Mutations (cont.) • These mutations are more damaging than point mutations • They can alter a protein so much that it is unable to perform its normal functions

  35. Chromosomal Mutations • Involve changes in the number or structure of chromosomes • Can change the location of genes on chromosomes • May even change the # of copies of some genes

  36. 4 Types of Chromosomal Mutations • Deletion – loss of all or part of the chromosome • Duplication – produces extra copies of parts of a chromosome • Inversion – reverse the direction of parts of chromosomes • Translocation – when part of one chromosome breaks off and attaches to another

  37. Chromosomal Mutations Original strand ABC-DEF Deletion AC-DEF Duplication ABBC-DEF Inversion AED-CBF Translocation ABC-JKL GH-JDEF

  38. Figure 12–20 Chromosomal Mutations Deletion Duplication Inversion Translocation Go to Section:

  39. Significance of Mutations • Many mutations are NEUTRAL – cause little or no damage to gene or proteins • Few mutations can cause dramatic changes that are very harmful and sometimes deadly • However, mutations can also be very beneficial, as a source of genetic variability to allow a species to adapt to changing environments

  40. “Discovering DNA” Film Questions • Which bases combine together in a DNA molecule? • Define a nucleotide. • What is a gene? • What is a genetic code? • Why are proteins so important in the functioning of a cell? • What are DNA polymerases? • Where do the nucleotides come from during DNA replication? • What are proteins made up of? • What organelle manufactures proteins? • What is a codon? • What does mRNA stand for? • What are ribosomes made of? • What does tRNA do? • Where do you find tRNA? • List 6 places where DNA is found.

  41. CODON BINGO • Fill in your bingo card with the proteins written on the board • You need to use all of proteins on your card • You need to use 3 of the proteins TWICE • When you are finished, open your books to page 303 • You will use the “Genetic Code” dial to help you with the game

  42. Proteins for Codon Bingo

  43. THE GENETIC CODE

  44. phosphate, deoxyribose, nitrogen base 2. Form organelles & control activities of the cell • A-T C-G ADENINE THYMINE CYTOSINE GUANINE • ATCGGCCTTAATTCGTACGTA TAGCCGGAATTAAGCATGCAT

More Related