1 / 19

Transforming Growth Factor-Beta Receptor 2 TGF- β receptor 2

Transforming Growth Factor-Beta Receptor 2 TGF- β receptor 2. In gastric cancer. 7 exons. Gene Information. TGF- β receptor 2, also called, TGF β RII or T β RII is located at 3p22.

damisi
Download Presentation

Transforming Growth Factor-Beta Receptor 2 TGF- β receptor 2

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Transforming Growth Factor-Beta Receptor 2TGF-β receptor 2 In gastric cancer

  2. 7 exons Gene Information TGF-β receptor 2, also called, TGFβRII or TβRII is located at 3p22 http://butler.cit.nih.gov/hembase/hembase.taf?_function=list&Chromosome=3&_UserReference=0666662AC360969CC75B2853 Ventura et al., Genome Res. 14:1696-1703, 2004

  3. TGF-β kinase domain TGF-β receptor 2 is a receptor serine-threonine kinase TβRII binds to TβRI This complex binds the ligand TGF- β Han-Kwang Yan Oncogene (1999) 18, 2213 ± 2219 Fig. 4 K. Pardali, A. Moustakas / Biochimica et Biophysica Acta 1775 (2007) 21–62 Fig. 1

  4. TGF-β Where is it found and what does it do? TGF-β receptor 2 is a receptor kinase:it is found in the plasma membrane It trans-phosphorylates TβRI which phosphorylates other molecules K. Pardali, A. Moustakas / Biochimica et Biophysica Acta 1775 (2007) 21–62 Fig. 1 http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=NM_001024847.1&dopt=gb

  5. How does the pathway work? First, meet the molecules Smads Types: R-Smads Co-Smad TGF-β TGF-β receptor 2 and TGF-β receptor 1

  6. How does the pathway work? To turn ON: 1) TGF-β binds to TβRII & TβRI complex 2) TβRII trans-phosphorylates TβRI 3) TβRI phosphorylates R-Smads 4) R-Smads move to nucleus and bind with Co-Smads 5) Complex binds to DNA and regulates transcription 1 2 3 4 5 K. Pardali, A. Moustakas / Biochimica et Biophysica Acta 1775 (2007) 21–62 Fig. 1

  7. So then what?We run into some old friends again TGF-β/Smad signaling induces directly transcription of p21, p27, p57, p15 And also represses transcription of c-Myc K. Pardali, A. Moustakas / Biochimica et Biophysica Acta 1775 (2007) 21–62 Fig. 2

  8. CDK p21 p15 Cyclin CDK Who are these again? p21, p27 and p57 are in the p21 family of CDK inhibitors that bind directly to CDK complex P15 is in the INK4 family of CDK inhibitors which replaces cyclin D in the complex c-Myc is an early response gene that encodes a transcription factor turned on by growth factors

  9. And to follow the pathway CDKI When TGF-β receptor 2 is active the pathway inhibits the CDKs CDKs do not phosphorylate pRb so the cell does not progress into S phase

  10. And the point is…? When TGF-β is turned on it either inhibits c-Myc or turns on CDK inhibitors which stop the cell in early G1 = NO PROLIFERATION K. Pardali, A. Moustakas / Biochimica et Biophysica Acta 1775 (2007) 21–62 Fig. 2

  11. Oncogene or Tumor Suppressor? The normal function of TGF-β complex is as a Tumor Suppressor TGF-β signaling inhibits proliferation and induces apoptosis Tumor Suppressor = Loss of Function

  12. Scientists explored what role TGF-βRII plays in normal development

  13. Day 9.5 yolk sac anemia Needed for vascular and blood cell development Day 10.5 Growth retardation Chimeric mice had cerebral hemorrhages, extra fluid in the brain, and cranial abnormalities The embryos did not survive past day 13.5 What happens when TGFβRII is knockout? TGFβRII required in early development Oshima, Masanobu Developmental Biology 179, 297–302 (1996)

  14. TGF-β Receptor 2 and gastric cancer Mutations in TGF β-Receptor 2 can contribute to the development of stomach tumors www.gihealth.com/images/imgStomachCancer.gif

  15. How cancer arises Loss of function of TGF-β receptor 2 causes continuous proliferation Because even if there is the ligand (TGF-β) the pathway is not activated and the cell cycle is not stopped

  16. One piece of evidence supporting this hypothesis The gastric cancer cell line SNU-5 was transfected with TGF-β, TGF-β RI, and TGF-β RII Recovery of normal function was found when TGF-β RII was added Han-Kwang Yan Oncogene (1999) 18, 2213 ± 2219 Fig. 5

  17. Microsatellites are repeats of a single base pair or a few base pairs Microsatellite in exon 3 attatgaaggaaaaaaaaaagcctggtgag What happens to TβRII to cause inactivation? Microsatellite instability Addition or deletion of a single base pair in the microsatellite can cause a frame shift mutation and inactivation of the kinase R.-J.Guo et al. Carcinogenesis vol.19 no.9 pp.1539–1544, 1998

  18. We know it is microsatellite instability because… Case B Case A Wild Type Wild Type has 10 adenines In Case A there was a single deletion In Case B there were two and three deletions In Case C there was an addition of adenine and guanine R.-J.Guo et al. Carcinogenesis vol.19 no.9 pp.1539–1544, 1998

  19. In Review TβRII acts as a tumor suppressor and inactivation can cause gastric cancer TβRII is inactivated by microsatellite instability which causes frame shift mutations Transforming Growth Factor Beta Receptor 2 is a serine/threonine receptorkinase that activates the SMAD transcription factors During normal development, its first role is in promoting development of thevascular systemIt's normal function in the gastrointestinal system is to activate CKDI orinhibit c-Myc, thus arresting the cell cycle in G1

More Related