1 / 51

Lecture 3

Lecture 3. Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database. How are different sizes of DNA strands separated on agarose gel?. Mixture of DNA molecules.

damita
Download Presentation

Lecture 3

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Lecture 3 • Lecture 2 catch up • Vector structure • Copy number control • Selectable marker • Plasmid DNA isolation • ESTs • DNA sequencing • Entering the Honeybee database

  2. How are different sizes of DNA strands separated on agarose gel? Mixture of DNA molecules

  3. (-) PCR1 PCR2 Decreasing Size (+) DNA separation is based on fragment size

  4. Size markers and their use to determine size

  5. Size markers and their use to determine size Mobility of a DNA fragment is proportional to the log of its size in bases.

  6. Plot of relative mobility of DNA vs log of size on semi-log graph paper

  7. DNA Ladders Varying concentrations of agarose How does one make a 0.7%, 1.0% & 1.5% agarose gel? Why are there varying concentrations of agarose gels?

  8. DNA Ladders Varying concentrations of agarose Why are there varying concentrations of agarose gels? Higher concentrations provide better resolution for smaller DNA fragments Lower concentrations provide better resolution for larger DNA fragments

  9. Experiment 1What is an EST?

  10. pT7T3-pac

  11. 3 important parts of a vector • Origin of replication • Selectable marker • Cloning sites

  12. Origin of replication: considerations • What is an origin of replication? • Why do we need one? • What properties should it have for easy plasmid DNA isolation?

  13. Replicon Contains all info necessary to begin and end DNA replication Origin of replication (Ori) is a defined location within the replicon where DNA synthesis begins

  14. The ColE1 origin of replication

  15. ColE1 origin • RNAII forms the primer for initiation of DNA synthesis • RNAI and Rop protein are negative regulatory functions: RNAI binds to RNAII stopping primer formation; Rop protein stabilizes the complex formed by RNAI and RNAII.

  16. The ColE1 origin of replication

  17. RNAI:RNAII interaction

  18. Rop protein negatively regulates the origin of replication by stabilizing the RNAI:RNAII interaction.

  19. Copy number

  20. Why does pT7T3.pac have a high copy number? • Point mutation in the origin that alters the initiation of RNAI transcription, such that the RNAI:RNAII complex does not form as well as wild-type. • The region of the origin that encodes Rop protein is deleted.

  21. Selectable Marker • Ampicillin resistance • Ampicillin is a penicillin derivative. • Blocks cross linking of the bacterial cell wall causing the cells to burst/lyse. • Ampicillin resistance gene encodes a secreted enzyme that cleaves the beta-lactam ring.

  22. Benzyl penicillin b-lactam ring

  23. Mechanism of resistance

  24. Plasmid DNA isolation • Separate chromosomal DNA from plasmid DNA • Remove protein • Remove RNA • Easy

  25. Starting material

  26. Lysis and denaturation

  27. Neutralization and centrifugation

  28. Column • Silica gel • DNA binds at high salt. • DNA is eluted at low salt. • Removes glycogen and other cellular components.

  29. ESTs • Expressed sequence tags? • What are they? • What do they represent? • What do we use them for? • What are their advantages?

  30. How is cDNA made? First strand synthesis GCGGCCGCGTTGCTTTTTTTTTTTTTT 3’ 3’ AAAAAAAAAAAAAAAAAAANNNNNNNNNNNN Reverse transcriptase

  31. Second strand synthesis Remove mRNA with OH or enzymatically DNA polymerase I Cut hairpin Add EcoRI adaptors GAATTCGGCACGAGG Cut with NotI and insert into EcoRI NotI of vector

  32. Normalized Library mRNAs accumulate to different levels in a mRNA sample. Normalization is a method of evening out the abundance levels using hybridization.

  33. T7 sequencing primer?

  34. Phosphodiester bond cannot form with incoming nucleotides leading to termination of DNA synthesis DNA SEQUENCING Dideoxy or Chain Termination Method 1974 Maxam/Gilbert (USA) (Chemical Cleavage protocol) Sanger (England) (natural process of DNA replication) *

  35. Sanger Sequencing in 1989

  36. ADD: Primer

  37. Example output

  38. Why is the size of the insert important? • A sequencing run may only go 500-700 bases. • What might you see and what might you not see?

  39. EST gel

  40. Clipping an EST sequence • What are we clipping out? • Why do we look for GAATTCGGCACGAGG and GCAACGCGGCCGC? • Why do we look for AAAAAAn?

  41. Example GAATTCGGCACGAGG CGCGTTCTTGAAAAGACAGGTAAAATGCGAGTTCCAGAATGGGTAGAATTGTAAAGTCTGCACGATTCAAGGAACTTGCTCCATATGATCCAGATTGGTATTATATTAGATGTGCTGCTTTAGTTCGTCATATTTATATTCGAAGTCCAATTGGTGTTGGAGCAGTAACAAAAATTTTTGGAGGACGCAAACGTAATGGTACTCATCCTAGCCATTTCTGTCGATCGGCAGGTGGTGTTGCTCGCAAAGCTCTTCAGAGCTTGGAACAACTTAAACTCATTGAAAAATCTCCAGTTGGTGGACGTAAACTTACCAGTCAAGGCCGTAGAGATTTAGATCGCATTGCTGCCCAAGTCAAAGCAAAAAGCAAAAAACAACTTAAGTTACAAGAAACTCTTGTTCTCTAATTTCTTTATTTCTATAATAAAAATTAAAAAATCGTACATTTATATTCAAATTTTATTTATTCTACTATTATAAGTTAATTTTAGAAGTCTTAAATAATTTAATGGTAACAAAATATCACAAGACAATGTGCTATTATTTTTTTAATTGTTTATGAATTATCATAATTGAGGAAATTTTTAACTATAAATAGATAAAGTAAGAAATATAAATTTATAATTTATGATTATGTATTTTATATCTAAATGTATTTATTAATCTAAATATAAACAAATATACAT AAAAAAAAAAAAAAAAAAAAAAAA GCAACGCGGCCGC AAGCTTATTCCCTTTAGTGAGGGTTAATTTTAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTC

  42. Example output

  43. What could go wrong • 18% of ESTs are in the reverse orientation. • Potential of 2 inserts in the clone. • What would this look like?

  44. Step into liquid

  45. Clipping a sequence I

  46. Clipping Sequence II

  47. Clipping Sequence III

  48. Clipping Sequence IV

More Related