GENETICS

1. GENETICS Pedigrees, Mutations and Karyotypes

2. Pedigree • Chart that shows how a trait and the genes that control it are inherited within a family Female Male Affected Person Carrier Marriage Connects Children & Parents Twins

3. Homozygous Recessive Disorders • Must have two recessive genes to have the disorder • Examples: • Tay-Sachs: the body can’t break down a certain lipid so it builds up in the brain; it is a fatal disorder • Cystic Fibrosis: excess mucus accumulates in the digestive tract and lungs

4. Dominant Allele Disorders • Rare because the offspring usually dies before sexual maturity is reached • If you have at least one dominant gene, you have the disorder • Huntington’s disease: disorder in which the brain deteriorates; doesn’t show symptoms until an individual is in his late 30’s or early 40’s

5. Genetic Counseling • If a disorder is present in past family members, genetic counselors can give parents the probability of passing the genetic disorder to their children • Genetic counselors construct pedigrees and use tests (i.e. alpha-fetoprotein, PKU) to determine probabilities

6. Mutations • Changes in the DNA that can involve one or more genes; Mutations can be: • Harmful: cause diseases or deformities • Helpful: organism is better able to survive • Neutral: organism is unaffected • If a mutation occurs in a sperm or egg cell, that mutation is passed onto offspring • If a mutation occurs in a body cell, that mutation affects only the organism and is not passed onto offspring

7. Gene Mutations • Random changes in the sequence of nucleotides in DNA • It’s a mistake that’s made during replication or transcription • There are 4 types: • Base Substitution • Base Deletion • Base Insertion • Jumping Gene

8. Base Substitution • One base is replaced by another base; this is also called a point mutation • ACGUCAGUA  Threonine—Serine—Valine • ACGUUAGUA  Threonine—Leucine—Valine • Depending on where the mutation occurs, it may have no affect on the protein • ACGUCAGUA  Threonine—Serine—Valine • ACGUCGGUA  Threonine—Serine—Valine • Wobble: Base pairing between codon and anticodon in which there is nonstandard pairing at the third position of the codon; allows more than one codon to pair with the same anticodon

9. Base Deletion • Deletion of a base that disrupts the codons; also called a frameshift mutation • ACGUCAGUA  Threonine—Serine—Valine • ACGUAGUAC  Threonine--STOP

10. Base Insertion • Insertion of a base that disrupts the codons; also called a frameshift mutation • ACGUCAGUAC Threonine—Serine—Valine • ACGUCGAGUAC  Threonine—Serine– Serine

11. Jumping Genes • Occur when large stretches of DNA are inserted into the gene; this can disrupt the DNA sequence • ACGTCAGTAC • ACGTCTACTGACGTAAGTAC

12. Chromosomal Mutations • Involve the entire chromosome • Deletion: a chromosome breaks and a piece of the chromosome is lost

13. Chromosomal Mutations (cont.) • Duplication: part of a chromosome breaks off and is incorporated into its homologous chromosome; the homologous chromosome now has an extra copy of one of its parts

14. Chromosomal Mutations (cont.) • Translocation: a part of a chromosome breaks off and attaches to a different, non-homologous chromosome

15. Chromosomal Mutations (cont.) • Inversion: a part of a chromosome breaks off, turns around, and reattaches in the reverse order

16. Genome & Karyotype • Genome: base sequence of all of the DNA in an organism • Karyotype: photograph of all of an organism’s chromosomes

17. Nondisjunction • Failure of the chromosomes to separate during cell division • If it occurs during mitosis, the individual cell is affected, but the organism is not usually harmed • If it occurs during meiosis, the entire organism is affected

18. Monosomy & Trisomy • Monosomy: the zygote has only one copy of a particular chromosome • Trisomy: the zygote has three copies of a particular chromosome • In humans, monosomy and trisomy are so disruptive in most chromosomes that it kills the embryo • In some chromosomes, however, the embryo survives, but it has developmental difficulties

19. Diseases Caused by Nondisjunction • Down’s Syndrome • Caused by trisomy of chromosome 21 • Symptoms include mental retardation and a “moon” face • Trisomy 18 • Caused by trisomy of chromosome 18 • Symptoms include a webbed neck, severe mental retardation, and hernia (inguinal, umbilical, and diaphramatic) • 90% mortality by 1 year

20. Diseases Caused by Nondisjunction (cont.) • Klinefelter’s Syndrome • Caused by trisomy of the sex chromosomes, XXY • Symptoms include lack of facial and body hair, rounded body type, and infertility • Turner’s Syndrome • Caused by monosomy of the sex chromosomes, XO • Symptoms include no sexual development, learning disabilities, infertility, heart & kidney abnormalities

21. Diseases Caused by Nondisjunction (cont.) • Trisomy 13 • Caused by trisomy of chromosome 13 • Symptoms include severe mental retardation and hernias (inguinal and umbilical) • 72% mortality by 1 year

22. Polyploidy • Nondisjunction occurs in all chromosome pairs • Almost always lethal in animals • Usually has a positive effect in plants