Selma de ANDRADE GOMES Lab. de Virologia Molecular IOC-FIOCRUZ

1. HBV/HIV co-infections: molecular and biological characterization of occult HBV strains or strains resistant to antiviral treatment ANRS N°12149 Selma de ANDRADE GOMES Lab. de Virologia Molecular IOC-FIOCRUZ Alan KAY Centre de Recherche en Cancérologie de Lyon (INSERM U1052) ANRS/Programa Nacional DST/AIDS Evaluation Meeting, Rio de Janeiro, 4-5 April 2011

2. History of the collaboration • In the early 2000s, our laboratory in Lyon was actively working on the problem of occult Hepatitis B Virus (HBV) infections: • Chemin, I., Zoulim, F., Merle, P., Arkhis, A., Chevallier, M., Kay, A., Cova, L., Chevallier, P., Mandrand, B., Trepo, C., 2001. High incidence of hepatitis B infections among chronic hepatitis cases of unknown aetiology. J Hepatol 34, 447-454. • Chemin, I., Jeantet, D., Kay, A., Trepo, C., 2001. Role of silent hepatitis B virus in chronic hepatitis B surface antigen(-) liver disease. Antiviral Res 52, 117-123  Jeantet, D., Chemin, I., Mandrand, B., Zoulim, F., Trepo, C., Kay, A., 2002. Characterization of two hepatitis B virus populations isolated from a hepatitis B surface antigen-negative patient. Hepatology 35, 1215-1224 In Rio de Janeiro at the same time, Selma GOMES was also working on occult HBV infections, and more specifically in HIV co-infected patients:  Gomes, S.A., Yoshida, C.F., Niel, C., 1996. Detection of hepatitis B virus DNA in hepatitis B surface antigen-negative serum by polymerase chain reaction: evaluation of different primer pairs and conditions. Acta Virol 40, 133-138  Santos, E.A., Yoshida, C.F., Rolla, V.C., Mendes, J.M., Vieira, I.F., Arabe, J., Gomes, S.A., 2003. Frequent occult hepatitis B virus infection in patients infected with human immunodeficiency virus type 1. Eur J Clin Microbiol Infect Dis 22, 92-98  Santos, E.A., Sucupira, M.V., Arabe, J., Gomes, S.A., 2004. Hepatitis B virus variants in an HIV-HBV co-infected patient at different periods of antiretroviral treatment with and without lamivudine. BMC Infect Dis 4, 29 Selma contacted our laboratory, and I visited Selma’s lab in 2005 We decided to apply for an INSERM/FIOCRUZ exchange agreement

3.  8%: High 2-7%:Intermediate < 2%: Low HBV infection • 350 million chronic HBV patients • > 10 times the number of HIV patients Brazil –Intermediateto high

4. A D A2 D C B D A A2 D F/H A D E D A F/H A D F A D A1 F2 D A1 D C B Geographic distribution of HBV genotypes Pujol and Devesa (2005) J Clin Gastroenterol. 39:611-8.

5. HBV DNA What is occult HBV infection? Acute infection: rapid loss (<6 months) of surface antigen (HBsAg) and HBV DNA Chronic infection: persistence (>6 months) of HBsAg, persistence of HBV DNA Occult HBV infection: detectable HBV DNA, HBsAg undetectable  DNA levels usually very low (<1000 copies/ml)  the virus can be transmitted  retains the oncogenic potential of chronic HBV infections

6. 2005-07 Occult HBV infection in the literature over years More Than 240 Number of publications 140 120 100 80 60 40 20 0 1980-89 1990-99 2000-04 2008-10 Chemin & Trepo J Clin Virol 2005, Adapted Raimondo et al, J Hepatol 2008

7. Occult HBV N° (%) Study Country N° patients Methods “nested” PCR (serial evaluation) 51 (89%) Hofer, 1998 57 Switzerland 7 (20%) 35 Torres-Baranda, 2006 Mexico “nested” PCR 17 (20%) Filippini, 2006 Italy single step PCR 86 South Africa “nested” PCR Mphahlele, 2006 31 (22.%) 140 93 Netherlands Pogany, 2005 4 (4%) single step PCR Cobas Amplicor HBV Monitor (Roche) Neau, 2005 France 1 (0.6%) 160 single step PCR 101 Brazil 16 (16%) Santos, 2003 11 (37%) 30 “nested” PCR France Wagner, 2004 8 (5%) “nested” PCR 159 Goncales, 2003 Brazil Cobas Amplicor HBV Monitor (Roche) 85 0 Nunez, 2002 Spain 37 Piroth, 2000 13 (35%) single step PCR France Italy 42 (41%) “nested” PCR (liver) 101 Raffa, 2007 Occult HBV and HIV co-infection Raimondo et al, J Hepaol 2007, modified

8. Rolling circle amplification (RCA) A new tool for amplifying full-length HBV genomes by completion and ligation of HBV RC-DNA to cccDNA T4 DNA polymerase + T4 DNA ligase Hybridization minus-strand primers DR1 DR1 DR2 DR2 In Vitro Complementation and Ligation HBV ccc-DNA HBV RC-DNA Elongation minus-strand DNA Strand Displacement Hybridization plus-strand primers End product – High molecular weight double-stranded DNA d.

9. HBV genome (3.2 kb) HBV genome (3.2 kb) 3 kb 3 kb Illustration of RCA Copies / reaction M H2O 103 102 10 1 0 Agarose gel of RCA products Southern blot of gel – HBV has been succesfully amplified Unit-length HBV genomes can be excised from RCA products – can be dirctly cloned and/or sequenced Sensitivity can be increased by doing A genomic PCR on RCA products 10 kb

10. Applications 1) Reactivation of an occult HBV infection in a HIV+ patient • Patient HIV+, anti-HBc+, anti-HBs+ - profile resolved acute HBV infection? • Reactivated occult HBV infection after glucocorticoid treatment • Amplified, cloned and sequenced full-length HBV genomes after RCA • Genomes are of subgenotype A2 (European genotype A) • No drug resistance mutations despite poor compliance of patient • Genomes viable – replication competent, secrete viral particles • What causes immune-escape from anti-HBs? ●all genomes contain 2 significant mutations in the S gene ● K122R – very rare in genotype A ● D144E – potential immune-escape mutant

11. C- C+ P C- C+ P C- C+ P C- C+ P Acute Infection < 6 Mo Occult Infection > 12 Yrs Glucocorticoid treatment Reactivation 2 Mo Antiviral treatment Seroconversion to a-HBe 6 Mo 1 Mo HBV- HIV+ Wild-type Virus K122/D144 HIV+ Emergence of K122R. Low-level HBV replication HIV+ Stimulation of HBV replication. Emergence of D144E HIV+ K122R/D144E HIV+ What can the patient’s serum recognize? • Genetically engineered genomes so that they express viral particles of wild-type HBsAg sequence, with K122R, D144E or both • Transfected into cells, labeled with 35S-Met/Cys, immuno-precipitated secreted viral particles K122/D144 K122R/D144 K122/D144E K122R/D144E C- = Normal human serum C+ = Serum from a vaccinated person P = Patient’s serum HBsAg

12. Spe I 1762 1762 DR1 RCA Spe I 1901 DR2 Full-length HBV genome 1762 HBV RC-DNA Applications 2) Mutations associated with HBeAg-negativity in subgenotype F2 prevalent in Brazil • HBeAg-negative mutants – important global health problem • Stop codon position 28 of precore region - not possible for genotype A or F2 • Anna KRAMVIS – subgenotype A1 – mutations in core promoter/precore region 1762 1764 1809 1812 1814 1858 1862 1896 1901 A G GCAC ATG T G TGG ATG Precore HBcAg T A T T C T A Core promoter Genotype A Subgenotype F2

13. 1762 1764 1809 1812 1814 1858 1862 1896 1901 #1 GGGGGAGGAGATTAGGTTAAAGGTCTTTGTATT//CCAGCACCATGCAA//CCCACTGTT//CTTTGGGGCATGGAC #2 GGGGGAGGAGATTAGGTTAAAGGTCTTTGTATT//CCAGCACCATGCAA//CCCACTGTT//CTTTGGGGCATGGAC #3 GGGKGAGGAGASTAGGTTAATGGTTTATGTATT//CCAGCACCATGCAA//CCCACTGTT//CTTTGGGACATGGAC #4 GGGKGAGGAGASTAGGTTAATGGTTTATGTATT//CCAGCACCATGCAA//CCCACTGTT//CTTTGGGACATGGAC F2 GGGGGAGGAGATTAGGTTAAAGGTCTTTGTATT//CCAGCACCATGCAA//CCCACTGTT//CTTTGGGGCATGGAC Precore HBcAg • Subtype F2 genomes do not show the mutations found with subtype A1 • Some isolates (#3 & 4) have A1762T but not G1764A • Isolates #3 & 4 have other mutations before and after 1762/1764 • Also have mutated codon 29 (GGC  GAC, Glycine  Tyrosine) • More work needed (sequence complete genomes, study HBeAg expression) Amplification and sequencing of genotype F genomes H20 RCA cut Spe I HBV full-legth genome RCA then genomic PCR using primers at Spe I site HBV full-legth genome

14. HIV interferes with the natural history of HBV infection by enhancing HBV replication, leading to more severe liver disease, decreasing hepatitis B ‘e’ antigen seroconversion and increasing HBV DNA levels • Due to the shared modes of transmission of HBV and HIV, the prevalence of HBV infected patients is higher than in non-HIV infected individuals • Occult HBV infection = Detection of HBV DNA in absence of HBsAg • Possible explanations: Low rate of HBV replication, mutations that inhibit HBsAg expression or change HBsAg antigenicity, thus preventing detection by commercial assays. • Among HIV-infected cohorts, occult HBV infection prevalence is widely divergent, ranging from 0% to 89%. HBV-HIV co-infection Jeantet et al., 2002

15. Demographical and serological data of HIV positive/ HBsAg negative patients HBsAg >10% (1998-2003), 2% 2009-2010

16. pre-S2 S EcoRV EcoRV Serological and molecular features of HBV isolates from cases of occult infection * LAM triple mutation HindIII HindIII EcoRV Transfection of eukariotic cells (CHO or HUH7) HindIII pcDNA3 S BIOELISA HBsAg Colour (Biokit)

17. Expression of HBsAg containing Y100C variant frequently detected in occult HBV infection

18. Regiã Conclusions/Perspectives Pol HIV OngoingstudiesatIPEC-Fiocruzshouldconfirmornottherecentdecreaseof HBV prevalence in the HIV infectedBrazilianpopulation, observedby us. Drugresistance: In agreement with dr. Couto-Fernandez (member of National Network for HIV Genotyping Lab. AIDS, IOC) we had designed a doctoral thesis to study the lamivudine and tenofovir resistance mutations of both HIV and HBV (populations and subpopulations by pyrosequencing) in cases of co-infectin. Unfortunately, the collaboration did not happen. We are inviting co-infected patients from IPEC to initiate this study.

19. Conclusions/Perspectives Studies of occult HBV infection in the sera and PBMC of HIV co-infected patients will also be carried out in France Future studies are needed to monitor transmission of HBV isolates from cases of occult infections/drug resistance The most appropriate therapy for a particular genotype or a mutation type may be identified by in vitro phenotyping Test: Transfection of complete genomes into human cells in the presence of drugs The study of mutations affecting HBeAg expression in Brazilian-specific genotypes/subtypes will also be continued

20. Valorization of the project (1) Publications Mello, Francisco C. A. ; Martel, Nora ; Gomes, Selma A. ; Araujo, Natalia M. .Expression of Hepatitis B Virus Surface Antigen Containing Y100C Variant Frequently Detected in Occult HBV Infection. Hepatitis Research and Treatment, v. 2011, p. 1-4, Araujo, N. M. ; Branco-Vieira M ; Silva ACM ; Pilotto JH ; Grinsztejn B ; Trepo C; Gomes, SA . Occult hepatitis B virus infection in HIV-infected patients:Evaluation of biochemical, virological and molecular parameters.. Hepatology Research, v. 38, p. 1194-1203, 2008 Araujo NM, Waizbort R, Kay A. Hepatitis B Virus infection from an evolutionary point of view: how viral, host, and environmental factors shape genotypes and subgenotypes. Infectious, Genetics and Evolution, 2011. (under revision) 2 other papers in preparation 1 Brazilian patent deposited 1 thesis in co-tutelle Instituo Oswaldo Cruz/Université Claude Bernard Lyon 1

21. Valorization of the project (2) A mini-symposium organized by Selma GOMES: “International Conferences and Debates on Relevant Aspects of Viral Hepatitis” IOC-FIOCRUZ, Rio de Janeiro, Brazil, February 26ty 2010 Participants: Selma GOMES, IOC-FIOCRUZ, Brazil: Introduction Anna KRAMVIS, Witwatersrand University, Johannesburg, South Africa: Phylogeny of Hepatitis B Virus Stephen Locarnini, Victoria Infectious Diseases Reference Laboratory, Melbourne, Australia: Drug resistance of Hepatitis B Virus Christoph COMBET, IBCP, Lyon, France: Hepatitis C virus genomic variability Alan Kay, INSERM U871, Lyon, France:Cell-culture models for HBV infectivityulture models for HBV infectivity Exchanges Rio de Janeiro Lyon Lyon  Rio de Janeiro Caroline SOARES Natalia ARAUJO Nora MARTEL PhD student, ANRS doctoral bursary Joint thesis IOC/UCBL1

22. French team Researchers/clinicians Dr Isabelle Chemin Pr. Christian Trepo Dr. Laurent Cotte Dr. Sophie Allain (Limoges PHD student Nora Martel Research team/ Acknowledgment • Collaborators (cohort of patients) • IPEC/Fiocruz (Dr.BeatrizGrinsztejn, Dr.JuçaraArabe • Other Financial Support • Brazil: CNPq/ France/Brazil: INSERM/FIOCRUZ Brazilian team • Researcher • Dr. Natalia M. Araujo • PHD students • Kelly C. Pereira