1 / 39

kcl.ac.uk/ schools/pse/bioinform/ christos.ouzounis@ kcl.ac.uk

artistic value in scientific results, a means for science communication creative king’s 10-mar-2009. http://www.kcl.ac.uk/ schools/pse/bioinform/ christos.ouzounis@ kcl.ac.uk. structure. BIOLOGY & BIOINFORMATICS visualization & interpretation of scientific results

deiondre
Download Presentation

kcl.ac.uk/ schools/pse/bioinform/ christos.ouzounis@ kcl.ac.uk

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. artistic value in scientific results,a means for science communicationcreative king’s10-mar-2009 http://www.kcl.ac.uk/schools/pse/bioinform/ christos.ouzounis@kcl.ac.uk

  2. structure • BIOLOGY & BIOINFORMATICS • visualization & interpretation of scientific results • who are we, the centre for bioinformatics • a crash course in biology • a movie: the inner life of a cell • CREATIVITY IN SCIENCE • creativity, definitions • importance of creativity, co-occurrence of terms • artists on science, scientists on art • science communication, good examples • ARTISTIC VALUE IN SCIENTIFIC RESULTS • importance of science? • neurobiology of perception • genome evolution, a case study • the importance of scales, and the media

  3. structure • BIOLOGY & BIOINFORMATICS • visualization & interpretation of scientific results • who are we, the centre for bioinformatics • a crash course in biology • a movie: the inner life of a cell • CREATIVITY IN SCIENCE • creativity, definitions • importance of creativity, co-occurrence of terms • artists on science, scientists on art • science communication, good examples • ARTISTIC VALUE IN SCIENTIFIC RESULTS • importance of science? • neurobiology of perception • genome evolution, a case study • the importance of scales, and the media

  4. what is bioinformatics? • The storage, analysis and distribution of biological information, usually at the molecular but also at the supra-molecular levels of organization • A ‘dirty’ word: • more traditionally… • sequence analysis • structure prediction • molecular evolution • and more to the definition… • data engineering [storage] • computational biology [analysis] • network services [distribution] • Overlaps with… • all the way from theoretical biology… • …to medical informatics and any other -matics or -omics • driving force behind genomics

  5. kcbiking’s college london centre for bioinformatics • structural genomics • fraternali • functional genomics • blanc • statistical genetics • schlitt • systems biology • tsoka • comparative genomics • ouzounis http://www.kcl.ac.uk/schools/pse/bioinform/

  6. School of Physical Sciences and Engineering Professor Christos Ouzounis Dr Sophia Tsoka Paul Keeling, Sr Admin Officer, strategic planning MRC Centre for Developmental Neurobiology Dr Eric Blanc Randall Division of Cell and Molecular Biophysics Dr Franca Fraternali Department of Medical and Molecular Genetics Dr Thomas Schlitt Department of Computer Science Professor Maxime Crochemore Professor Mark Harman Professor Costas Iliopoulos Dr Kathleen Steinhöfel Division of Engineering Dr Mark Miodownik School of Medicine Professor Frank Nestle Dr Rebecca Oakey Dr Roli Roberts Dr Reiner Schulz Institute of Psychiatry Professor Simon Lovestone MRC Centre for Developmental Neurobiology Dr David Chambers Mathematics Department Professor Ton Coolen Visiting Professors Ben Blencowe, University of Toronto Peter D. Karp, SRI International, Benlo Park CA Nikos Kyrpides, Joint Genome Institute, Berkeley CA Arthur Lesk, Penn State University, University Park PA Alfonso Valencia, CNIO Madrid, Spain core and associate members

  7. a visual summary of our work

  8. the very basics • the biological hierarchy • populations • organisms • systems • organs • tissues • cell types • cells • subcellular compartments • macromolecular complexes • macromolecules • small molecules • atoms • … http://www.ehponline.org/members/2007/10373/fig1.jpg http://kentsimmons.uwinnipeg.ca/cm1504/Image48.gif

  9. from DNA to gene • measuring length: • Units of length for DNA molecules • Because DNA is double-stranded, the lengths of molecules are described as so many base pairs (bp). • A kilobase pair (kb) is 103 bp and a megabase pair (Mb) is 106 bp. • A gigabase pair (Gb) is 109 Mb. • In summary: • 1 kb = 1000 bp • 1 Mb = 1000 kb = 1 000 000 bp • 1 Gb = 1000 Mb = 1 000 000 kb = 1 000 000 000 bp • Typically, genome sizes range from Mbs to Gbs - and they contain between 1,000 and 100,000 genes http://www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=genomes.box.5275

  10. a gene in ascii : acgt ATGCCCGTTGCCCACGTTGCCTTGCCCGTTCCGCTTCCTCGTACCTTTGACTATCTGCTGCCAGAAGGCATGACGGTTAAAGCTGGGTGTCGCGTGCGCGTGCCGTTTGGCAAACAGCAGGAGCGCATCGGGATTGTGGTATCAGTTAGCGATGCCAGCGAACTGCCGCTCAATGAGCTAAAAGCGGTAGTCGAAGTGCTGGATAGTGAGCCGGTGTTTACTCACTCCGTCTGGCGATTGCTGCTATGGGCGGCAGATTACTATCATCATCCGATTGGCGATGTGCTGTTTCATGCCTTGCCGATTTTACTACGCCAGGGGCGGCCTGCGGCGAACGCGCCGATGTGGTACTGGTTTGCCACTGAACAAGGCCAGGCGGTGGATCTGAACAGCCTGAAACGCTCCCCCAAGCAACAACAGGCGCTGGCGGCGTTACGGCAAGGCAAAATCTGGCGCGACCAGGTCGCCACGCTCGAATTTAATGATGCCGCGTTGCAGGCGCTACGCAAAAAAGGTCTGTGTGATTTAGCAAGTGAAACACCAGAGTTTAGCGACTGGCGAACGAACTATGCCGTTTCTGGTGAGCGGTTGCGATTGAATACCGAACAGGCCACCGCCGTTGGCGCAATTCATAGCGCGGCAGATACTTTTTCTGCCTGGCTGCTGGCGGGCGTTACCGGTTCCGGTAAAACGGAGGTTTATCTCAGCGTACTGGAAAACGTGCTCGCTCAGGGCAAACAGGCGCTGGTGATGGTGCCGGAAATCGGCCTGACACCGCAAACTATCGCCCGTTTTCGTGAACGTTTTAATGCCCCCGTGGAAGTTCTGCATTCCGGCCTGAACGACAGCGAGCGTCTTTCGGCGTGGCTGAAAGCGAAAAATGGTGAGGCGGCGATTGTGATCGGCACCCGCTCCGCGCTGTTTACGCCGTTTAAAAATCTCGGCGTGATTGTCATTGATGAAGAGCACGACAGCTCCTACAAGCAGCAGGAAGGCTGGCGCTATCATGCCCGCGACCTGGCGGTGTATCGTGCGCACAGCGAGCAAATCCCGATTATTCTTGGCTCCGCAACGCCCGCGCTGGAAACGTTATGCAACGTCCAGCAGAAAAAATACCGCCTGCTGCGCCTGACCCGTCGGGCAGGGAATGCGCGTCCGGCAATTCAACATGTGCTGGATTTAAAAGGTCAGAAGGTGCAGGCAGGTCTGGCTCCGGCGTTAATCACTCGTATGCGCCAGCATTTACAGGCTGATAACCAGGTCATTCTCTTTCTTAACCGCCGTGGCTTTGCGCCTGCACTGCTGTGCCACGACTGTGGCTGGATTGCCGAATGCCCACGTTGCGATCACTACTACACGCTGCATCAGGCGCAGCACCATCTGCGCTGCCACCACTGTGACAGTCAGCGTCCGGTGCCGCGCCAGTGCCCTTCCTGCGGTTCCACGCACCTGGTCCCCGTGGGGCTGGGCACCGAACAGCTTGAACAGACGCTCGCGCCGTTGTTCCCCGGCGTGCCCATTTCTCGTATCGACCGCGATACCACCAGCCGCAAAGGGGCGCTGGAACAGCAACTGGCAGAAGTACATCGCGGCGGCGCGCGGATTTTGATTGGTACACAAATGCTGGCGAAAGGTCACCATTTCCCGGATGTGACGCTGGTTGCATTACTGGACGTGGACGGCGCGCTGTTTTCTGCCGATTTTCGCTCGGCAGAGCGTTTCGCTCAGCTTTACACCCAGGTCGCCGGTCGTGCCGGGCGTGCGGGTAAACAGGGCGAAGTGGTGCTGCAAACGCACCATCCGGAACATCCTCTGTTGCAAACGTTGCTCTATAAAGGCTACGACGCCTTTGCCGAACAGGCGCTGGCTGAGCGGCGAATGATGCAGCTACCGCCGTGGACCAGCCATGTGATTGTGCGTGCGGAAGATCATAACAATCAGCACGCGCCATTGTTCCTGCAACAACTGCGTAATCTGATCCTCTCCAGCCCACTGGCAGACGAGAAACTGTGGGTTCTCGGTCCGGTTCCGGCTCTGGCACCTAAACGTGGCGGTCGCTGGCGCTGGCAGATATTGTTGCAGCACCCTTCCCGCGTGCGCTTGCAACACATCATTAACGGTACGCTGGCGCTCATCAATACAATACCGGATTCCCGTAAGGTGAAATGGGTGCTGGATGTTGATCCGATTGAGGGTTAA

  11. a protein in ascii : acdefghiklmnpqrstvwy MPVAHVALPVPLPRTFDYLLPEGMTVKAGCRVRVPFGKQQERIGIVVSVSDASELPLNELKAVVEVLDSEPVFTHSVWRLLLWAADYYHHPIGDVLFHALPILLRQGRPAANAPMWYWFATEQGQAVDLNSLKRSPKQQQALAALRQGKIWRDQVATLEFNDAALQALRKKGLCDLASETPEFSDWRTNYAVSGERLRLNTEQATAVGAIHSAADTFSAWLLAGVTGSGKTEVYLSVLENVLAQGKQALVMVPEIGLTPQTIARFRERFNAPVEVLHSGLNDSERLSAWLKAKNGEAAIVIGTRSALFTPFKNLGVIVIDEEHDSSYKQQEGWRYHARDLAVYRAHSEQIPIILGSATPALETLCNVQQKKYRLLRLTRRAGNARPAIQHVLDLKGQKVQAGLAPALITRMRQHLQADNQVILFLNRRGFAPALLCHDCGWIAECPRCDHYYTLHQAQHHLRCHHCDSQRPVPRQCPSCGSTHLVPVGLGTEQLEQTLAPLFPGVPISRIDRDTTSRKGALEQQLAEVHRGGARILIGTQMLAKGHHFPDVTLVALLDVDGALFSADFRSAERFAQLYTQVAGRAGRAGKQGEVVLQTHHPEHPLLQTLLYKGYDAFAEQALAERRMMQLPPWTSHVIVRAEDHNNQHAPLFLQQLRNLILSSPLADEKLWVLGPVPALAPKRGGRWRWQILLQHPSRVRLQHIINGTLALINTIPDSRKVKWVLDVDPIEG

  12. many genomes have been deciphered

  13. domains of life • there are three known domains / types of cells: archaea, bacteria, eukarya http://www.garlandscience.com/textbooks/0815341059.asp http://www.biologyreference.com/Ar-Bi/Archaea.html http://tainano.com/Molecular%20Biology%20Glossary.files/image015.gif

  14. genome trees • better trees are derived from whole-genome comparisons

  15. the eukarya, us • eukarya are very diverse ! http://wiki.cotch.net/upload/5/5f/Eukaryoticlife.jpg

  16. structure • BIOLOGY & BIOINFORMATICS • visualization & interpretation of scientific results • who are we, the centre for bioinformatics • a crash course in biology • a movie: the inner life of a cell • CREATIVITY IN SCIENCE • creativity, definitions • importance of creativity, co-occurrence of terms • artists on science, scientists on art • science communication, good examples • ARTISTIC VALUE IN SCIENTIFIC RESULTS • importance of science? • neurobiology of perception • genome evolution, a case study • the importance of scales, and the media

  17. creativity

  18. creativity, co-occurrence terms

  19. creativity barometer

  20. creativity in society

  21. visual arts in sciences

  22. artists on science, scientists on art • a relevant dialogue, e.g. "Artists on science: scientists on art." Special section in Nature, 17 March 2005, pages 293-323 • distinction of “two cultures”, science & technology vs. art & poetry is somewhat outdated • “… There is an economy of words and beauty of concept in poetry that is always found in the best science” (Garfield, 1989) • Creativity is a modern concept. Term was not coined until 1875, when it was used to refer to the poetic imagination.

  23. http://www.ucmp.berkeley.edu/history/vinci.html a piece of art from a famous scientist “It may seem unusual to include Leonardo da Vinci in a list of paleontologists and evolutionary biologists. Leonardo was and is best known as an artist, the creator of such masterpieces as the Mona Lisa, Madonna of the Rocks, and The Last Supper. Yet Leonardo was far more than a great artist: he had one of the best scientific minds of his time. He made painstaking observations and carried out research in fields ranging from architecture and civil engineering to astronomy to anatomy and zoology to geography, geology and paleontology.”

  24. http://www.auburn.edu/~mathest/nufs2000_clip_image002_0000.jpghttp://www.auburn.edu/~mathest/nufs2000_clip_image002_0000.jpg http://www.flickr.com/photos/rafaerts/2817098501/ the importance of science communication

  25. structure • BIOLOGY & BIOINFORMATICS • visualization & interpretation of scientific results • who are we, the centre for bioinformatics • a crash course in biology • a movie: the inner life of a cell • CREATIVITY IN SCIENCE • creativity, definitions • importance of creativity, co-occurrence of terms • artists on science, scientists on art • science communication, good examples • ARTISTIC VALUE IN SCIENTIFIC RESULTS • importance of science? • neurobiology of perception • genome evolution, a case study • the importance of scales, and the media

  26. the importance of science? Science poll Published: Wednesday, 28 January 2009 The public was asked what has the most impact in shaping their futures; 26% said science, putting it ahead of politics, family and religion. When asked to choose which group of people has the most effect on our daily lives, only 3% selected scientists. http://sciencesowhat.direct.gov.uk/

  27. neurobiology of perception Elements of perspective, shadows, transparency, reflections: all understood in terms of visual computations in our brain

  28. microphotography http://www.nikonsmallworld.com/

  29. a sense of scale

  30. protein classification & similarity graphs http://bioinformatics.icmb.utexas.edu/lgl/Images/phg.jpg http://bioinformatics.icmb.utexas.edu/lgl/Images/scop_hie_full.jpg

  31. http://bioinformatics.icmb.utexas.edu/lgl/PHN/phn.large.png more views of the similarity graph

  32. zooming into the unknown

  33. a sense of scale

  34. ancestral gene content

  35. 1708

  36. Gene content reconstruction: ancestral states Both current and ancient genomes HGT events on tree The enigmatic yellow sphere is the universal ancestor Featured in Wired, Discover etc. network of life

  37. net of life, the movie http://www.nature.com/embor/journal/v8/n10/full/7401074.html

  38. the importance of scales, and the media • for artists, other scales do not provide typical material • there is a beauty in the microcosm, stunning views that need to be captured • stunning representations of complex phenomena with artistic value • inaccessible in their usual form to wider communities • including other scientists, artists and the general public • these representations (“results”) are abstract notions • they do not correspond to the physical world • they do, however, provide the means for effective science communication with the appropriate use of media and inter-disciplinary collaborations • results of complex analyses can have both artistic content and scientific accuracy

More Related