1 / 50

DNA Sequencing: Techniques and Technologies for Obtaining Genetic Information

Discover the fascinating world of DNA sequencing and how we obtain the sequence of nucleotides of different species. Learn about technologies like gel electrophoresis, fragment assembly, and more. Explore the human population migrations, polymorphism rates, and the challenges faced in sequencing long DNA strands. Uncover the secrets of human variation, Y chromosome DNA sequencing, and the importance of coverage in sequencing. Dive into the intricate process of fragment assembly and how to handle repetitive regions in DNA sequences.

denton
Download Presentation

DNA Sequencing: Techniques and Technologies for Obtaining Genetic Information

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. DNA Sequencing

  2. DNA sequencing How we obtain the sequence of nucleotides of a species …ACGTGACTGAGGACCGTG CGACTGAGACTGACTGGGT CTAGCTAGACTACGTTTTA TATATATATACGTCGTCGT ACTGATGACTAGATTACAG ACTGATTTAGATACCTGAC TGATTTTAAAAAAATATT…

  3. Which representative of the species? Which human? Answer one: Answer two: it doesn’t matter Polymorphism rate: number of letter changes between two different members of a species Humans: ~1/2,000 Other organisms have much higher polymorphism rates

  4. Human population migrations • Out of Africa, Replacement • Single mother of all humans (Eve) ~150,000yr • Single father of all humans (Adam) ~70,000yr • Humans out of Africa ~40000 years ago replaced others (e.g., Neandertals) • Evidence: mtDNA • Multiregional Evolution • Fossil records show a continuous change of morphological features • Proponents of the theory doubt mtDNA and other genetic evidence

  5. Why humans are so similar A small population that interbred reduced the genetic variation Out of Africa ~ 40,000 years ago Out of Africa

  6. Migration of human variation http://info.med.yale.edu/genetics/kkidd/point.html

  7. http://info.med.yale.edu/genetics/kkidd/point.html Migration of human variation

  8. http://info.med.yale.edu/genetics/kkidd/point.html Migration of human variation

  9. Human variation in Y chromosome

  10. DNA Sequencing – Overview 1975 • Gel electrophoresis • Predominant, old technology by F. Sanger • Whole genome strategies • Physical mapping • Walking • Shotgun sequencing • Computational fragment assembly • The future—new sequencing technologies • Pyrosequencing, single molecule methods, … • Assembly techniques • Future variants of sequencing • Resequencing of humans • Microbial and environmental sequencing • Cancer genome sequencing 2015

  11. DNA Sequencing Goal: Find the complete sequence of A, C, G, T’s in DNA Challenge: There is no machine that takes long DNA as an input, and gives the complete sequence as output Can only sequence ~500 letters at a time

  12. DNA Sequencing – vectors DNA Shake DNA fragments Known location (restriction site) Vector Circular genome (bacterium, plasmid) + =

  13. Different types of vectors

  14. DNA Sequencing – gel electrophoresis • Start at primer (restriction site) • Grow DNA chain • Include dideoxynucleoside (modified a, c, g, t) • Stops reaction at all possible points • Separate products with length, using gel electrophoresis

  15. Electrophoresis diagrams

  16. Challenging to read answer

  17. Challenging to read answer

  18. Challenging to read answer

  19. Reading an electropherogram • Filtering • Smoothening • Correction for length compressions • A method for calling the letters – PHRED PHRED – PHil’s Read EDitor (by Phil Green) Several better methods exist, but labs are reluctant to change

  20. Output of PHRED: a read A read: 500-700 nucleotides A C G A A T C A G …A 16 18 21 23 25 15 28 30 32 …21 Quality scores: -10log10Prob(Error) Reads can be obtained from leftmost, rightmost ends of the insert Double-barreled sequencing: (1990) Both leftmost & rightmost ends are sequenced, reads are paired

  21. Method to sequence longer regions genomic segment cut many times at random (Shotgun) Get one or two reads from each segment ~500 bp ~500 bp

  22. Reconstructing the Sequence (Fragment Assembly) reads Cover region with ~7-fold redundancy (7X) Overlap reads and extend to reconstruct the original genomic region

  23. Definition of Coverage C Length of genomic segment: L Number of reads: n Length of each read: l Definition:Coverage C = n l / L How much coverage is enough? Lander-Waterman model: Assuming uniform distribution of reads, C=10 results in 1 gapped region /1,000,000 nucleotides

  24. Repeats Bacterial genomes: 5% Mammals: 50% Repeat types: • Low-Complexity DNA (e.g. ATATATATACATA…) • Microsatellite repeats (a1…ak)N where k ~ 3-6 (e.g. CAGCAGTAGCAGCACCAG) • Transposons • SINE(Short Interspersed Nuclear Elements) e.g., ALU: ~300-long, 106 copies • LINE(Long Interspersed Nuclear Elements) ~4000-long, 200,000 copies • LTRretroposons(Long Terminal Repeats (~700 bp) at each end) cousins of HIV • Gene Families genes duplicate & then diverge (paralogs) • Recent duplications ~100,000-long, very similar copies

  25. AGTAGCACAGACTACGACGAGACGATCGTGCGAGCGACGGCGTAGTGTGCTGTACTGTCGTGTGTGTGTACTCTCCTAGTAGCACAGACTACGACGAGACGATCGTGCGAGCGACGGCGTAGTGTGCTGTACTGTCGTGTGTGTGTACTCTCCT Sequencing and Fragment Assembly 3x109 nucleotides 50% of human DNA is composed of repeats Error! Glued together two distant regions

  26. What can we do about repeats? Two main approaches: • Cluster the reads • Link the reads

  27. What can we do about repeats? Two main approaches: • Cluster the reads • Link the reads

  28. What can we do about repeats? Two main approaches: • Cluster the reads • Link the reads

  29. AGTAGCACAGACTACGACGAGACGATCGTGCGAGCGACGGCGTAGTGTGCTGTACTGTCGTGTGTGTGTACTCTCCTAGTAGCACAGACTACGACGAGACGATCGTGCGAGCGACGGCGTAGTGTGCTGTACTGTCGTGTGTGTGTACTCTCCT A R B D R C Sequencing and Fragment Assembly 3x109 nucleotides ARB, CRD or ARD, CRB ?

  30. AGTAGCACAGACTACGACGAGACGATCGTGCGAGCGACGGCGTAGTGTGCTGTACTGTCGTGTGTGTGTACTCTCCTAGTAGCACAGACTACGACGAGACGATCGTGCGAGCGACGGCGTAGTGTGCTGTACTGTCGTGTGTGTGTACTCTCCT Sequencing and Fragment Assembly 3x109 nucleotides

  31. Strategies for whole-genome sequencing • Hierarchical – Clone-by-clone • Break genome into many long pieces • Map each long piece onto the genome • Sequence each piece with shotgun Example: Yeast, Worm, Human, Rat • Online version of (1) – Walking • Break genome into many long pieces • Start sequencing each piece with shotgun • Construct map as you go Example: Rice genome • Whole genome shotgun One large shotgun pass on the whole genome Example: Drosophila, Human (Celera), Neurospora, Mouse, Rat, Dog

  32. Hierarchical Sequencing

  33. a BAC clone map Hierarchical Sequencing Strategy • Obtain a large collection of BAC clones • Map them onto the genome (Physical Mapping) • Select a minimum tiling path • Sequence each clone in the path with shotgun • Assemble • Put everything together genome

  34. Methods of physical mapping Goal: Make a map of the locations of each clone relative to one another Use the map to select a minimal set of clones to sequence Methods: • Hybridization • Digestion

  35. 1. Hybridization Short words, the probes, attach to complementary words • Construct many probes • Treat each BAC with all probes • Record which ones attach to it • Same words attaching to BACS X, Y  overlap p1 pn

  36. Hybridization – Computational Challenge p1p2 …………………….pm 0 0 1 …………………..1 Matrix: m probes  n clones (i, j): 1, if pi hybridizes to Cj 0, otherwise Definition: Consecutive ones matrix 1s are consecutive in each row & col Computational problem: Reorder the probes so that matrix is in consecutive-ones form Can be solved in O(m3) time (m > n) C1C2 ……………….Cn 1 1 0 …………………..0 1 0 1…………………...0 pi1pi2…………………….pim 1 1 1 0 0 0……………..0 0 1 1 1 1 1……………..0 0 0 1 1 1 0……………..0 Cj1Cj2 ……………….Cjn 0 0 0 0 0 0………1 1 1 0 0 0 0 0 0 0………0 1 1 1

  37. Hybridization – Computational Challenge pi1pi2………………………………….pim pi1pi2…………………….pim If we put the matrix in consecutive-ones form, then we can deduce the order of the clones & which pairs of clones overlap 1 1 1 0 0 0……………..0 0 1 1 1 1 1……………..0 0 0 1 1 1 0……………..0 Cj1Cj2 ……………….Cjn Cj1Cj2 ……………….Cjn 0 0 0 0 0 0………1 1 1 0 0 0 0 0 0 0………0 1 1 1

  38. Hybridization – Computational Challenge p1p2 …………………….pm 0 0 1 …………………..1 Additional challenge: A probe (short word) can hybridize in many places in the genome Computational Problem: Find the order of probes that implies the minimal probe repetition Equivalent: find the shortest string of probes such that each clone appears as a substring APX-hard Solutions: Greedy, probabilistic, lots of manual curation C1C2 ……………….Cn 1 1 0 …………………..0 1 0 1…………………...0

  39. 2. Digestion Restriction enzymes cut DNA where specific words appear • Cut each clone separately with an enzyme • Run fragments on a gel and measure length • Clones Ca, Cb have fragments of length { li, lj, lk }  overlap Double digestion: Cut with enzyme A, enzyme B, then enzymes A + B

  40. Online Clone-by-cloneThe Walking Method

  41. The Walking Method • Build a very redundant library of BACs with sequenced clone-ends (cheap to build) • Sequence some “seed” clones • “Walk” from seeds using clone-ends to pick library clones that extend left & right

  42. Walking: An Example

  43. Walking off a Single Seed • Low redundant sequencing • Many sequential steps

  44. Walking off a single clone is impractical • Cycle time to process one clone: 1-2 months • Grow clone • Prepare & Shear DNA • Prepare shotgun library & perform shotgun • Assemble in a computer • Close remaining gaps • A mammalian genome would need 15,000 walking steps !

  45. Walking off several seeds in parallel • Few sequential steps • Additional redundant sequencing In general, can sequence a genome in ~5 walking steps, with <20% redundant sequencing Efficient Inefficient

  46. Whole-Genome Shotgun Sequencing

  47. cut many times at random Whole Genome Shotgun Sequencing genome plasmids (2 – 10 Kbp) forward-reverse paired reads known dist cosmids (40 Kbp) ~500 bp ~500 bp

More Related