1 / 13

ASSOCIATION OF MCP-1/CCL2 GENE POLYMORPHISM WITH ACUTE GRAFT VERSUS HOST DISEASE AFTER ALLOGENEIC HAEMATOPOIETIC STEM CE

ASSOCIATION OF MCP-1/CCL2 GENE POLYMORPHISM WITH ACUTE GRAFT VERSUS HOST DISEASE AFTER ALLOGENEIC HAEMATOPOIETIC STEM CELL TRANSPLANTATION. Z. Ambruzova 1 , B. Vidan-Jeras 3 , L. Raida 2 , F. Mrazek 1 , M. Jeras 3 , E. Faber 2 , A. Stahelova 1 , J. Pretnar 4 , K. Indrak 2 , M. Petrek 1

didina
Download Presentation

ASSOCIATION OF MCP-1/CCL2 GENE POLYMORPHISM WITH ACUTE GRAFT VERSUS HOST DISEASE AFTER ALLOGENEIC HAEMATOPOIETIC STEM CE

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. ASSOCIATION OF MCP-1/CCL2 GENE POLYMORPHISM WITH ACUTE GRAFT VERSUS HOST DISEASE AFTER ALLOGENEIC HAEMATOPOIETIC STEM CELL TRANSPLANTATION Z. Ambruzova1, B. Vidan-Jeras3,L. Raida2, F. Mrazek1, M. Jeras3, E. Faber2, A. Stahelova1, J. Pretnar4, K. Indrak2, M. Petrek1 1Laboratory of Immunogenomics, Dept. of Immunology, 2Department of Haematooncology, Medical Faculty Palacky University and University Hospital Olomouc, Czech Republic, 3Blood Transfusion Center of Slovenia, 4Department of Haematology, University Clinical Centre Ljubljana, Slovenia Supported by Czech Govt. Funding MSM 6198959205 and IGA MZCR NR9099

  2. BACKGROUND • acute graft versus host disease (aGVHD) is the most serious complication of the allogeneic haematopoietic stem cell transplantation (aHSCT) and substantiallyinfluences its outcome • chemokines are molecules implicated in the activation phase of aGVHD; they attract donor T cells activated in lymphoid tissues to the target organs which leads to the clinical manifestation of aGVHD (Wysocki 2005) • functional polymorphisms of the chemokine genes may affect migration and distribution of donor T cells in the host tissues and, therefore,might influence occurence and severity of aGVHD

  3. MONOCYTE CHEMOATTRACTANT PROTEIN-1(MCP-1) • MCP-1 (CC chemokine ligand 2, CCL2) acts via interaction with the chemokine receptor CCR2 • MCP-1 plays as a potent attractant of mononuclear cellsand is implicatedin the recruitment and migration of leukocytes to the sites of inflammation • variations in MCP-1 expression have been studied in many diseases associated with organ inflammation (Petrek 2002, Arakelyan 2005)

  4. MCP-1/CCL2 GENE POLYMORPHISM • CCL2 gene is polymorphic and its genetic variants can modulate MCP-1 production • functional single nucleotide polymorphism (SNP) in distal regulatory region at position -2518 may affect the level of MCP-1 protein expression (G allele is associated with increased MCP-1 secretion in vitro) (Rovin 1999) • several studies of the impact of MCP-1 gene variants on posttransplantation outcome after organ transplantation were performed (Lacha 2005, Schröppel 2002)

  5. AIM OF THE STUDY to investigate if there exists an association between: MCP-1/CCL2 gene polymorphism -2518 A/G occurence of acute GVHD after aHSCT

  6. INVESTIGATED SUBJECTS Number of donor-recipient pairs 141 center Olomouc 88 center Ljubljana 53 Median age, years (range) Donor HLA compatibility patients 40 (17-64) identical 141 donors 41 (19-69) mismatched 0 Recipient sex Donor type female 58 sibling 107 male 83other related donor 4 Diseases unrelated 30 acute leukemia (AML, ALL) 79Graft source chronic leukemia (CML,CLL) 25 PBSC 124 NHL 14 BM 17 other23Acute GVHD Conditioning regimen Grade 0-I 89 non-myeloablative 55 Grade II 35 myeloablative 86 Grade III 8 Sex of donor and recipient Grade IV 9 male with female donor 31 all others combinations 110

  7. METHODS 1. MCP-1/CCL2 -2518 SNP genotyping Polymerase Chain Reaction with Sequence Specific Primers(PCR-SSP) Primers designed according to the reference CCL2 gene sequence MCP-1-2518 A/G (rs1024611) Specific 1 (wild type) *A: 5´GTGGGAGGCAGACAGCTA3´ Specific 2 (mutant type) *G: 5´GTGGGAGGCAGACAGCTG3´ Constant: 5´TGAGTGTTCACATAGGCTTC3´ 2. Statistics Conformity to the Hardy-Weinberg equilibrium: Chi-square test Differences between allele and genotype frequencies: Chi-squaretest with Woolf-Haldane correction in cases of small numbers

  8. RESULTS • overrepresentation of MCP-1-2518*G allele among recipients with aGVHD (28%) compared to those without aGHVD (17%, p=0.03) (Table 1, Figure 1) • recipients carrying MCP-1-2518*G allele developed aGVHD more frequently (50%) than MCP-1-2518 AA homozygous individuals (33%, p=0.04) (Figure 2) • no association between the presence of MCP-1-2518 alleles/genotypes in donors and development of aGVHD was found

  9. Table 1: Genotype and allele frequencies of the MCP-1-2518 A/G SNP in the groups of patients with/without aGVHD Patients aGVHD+ Patients aGVHD- Genotype frequency n= 52 n= 80 Genotype AA 0.50 (26) 0.68 (54) Genotype GA 0.44 (23) 0.31 (25) Genotype GG 0.06 (3) 0.01 (1) Allele frequency n= 104 n= 160 Allele A 0.72 (75) 0.83 (133) Allele G 0.28 (29) 0.17 (27) p = 0.03

  10. Figure 1: MCP-1-2518*G allele frequency in patients according to the presence/absence of acute GVHD p = 0.03

  11. Figure 2: Occurence of acute GVHD in carriers/non-carriers of MCP-1-2518*G allele p = 0.04

  12. CONCLUSION Our study revealed association between MCP-1-2518*G allele in recipients and aGVHD in Czech and Slovenian patients after aHSCT. This data suggest that MCP-1-2518 gene polymorphism may contribute to the development of acute GVHD at least in West-Slavonic populations. Replication on further cohorts / populations and data on MCP-1 expression in aGVHD may clarify real contribution of the MCP-1-2518 variants to the development of GVHD.

  13. REFERENCES Arakelyan A, Petrkova J, Hermanova Z, Boyajyan A, Lukl J, Petrek M: Serum levels ofthe MCP-1 chemokine in patients with ischemic stroke and myocardial infarction.Mediators Inflamm 2005;3:175-9 Lacha J, Hribova P, Kotsch K, Brabcova I, Bartosova K. Volk HD, Vitko S: Effect of cytokines and chemokines (TGF-beta, TNF-alpha, IL-6, IL-10, MCP-1, RANTES) gene polymorphisms in kidney recipients on posttransplantation outcome: influence of donor-recipient match. Transplant Proc 2005; 37: 764-6 Petrek M, Kolek V, Szotkowska J, du Bois RM: CC and C chemokine expression in pulmonarysarcoidosis. Eur Respir J 2002; 20: 1206-12 Rovin BH, Lu L, Saxena R: A novel polymorphism in the MCP-1 gene regulatory region that influences MCP-1 expression. Biochem Biophys Res Commun 1999; 259: 344-8 Schröppel B, Fischereder M, Lin M, Marder B, Schiano T, Krämer BK, Murphy B: Analysis of gene polymorphisms in the regulatory region of MCP-1, RANTES and CCR5 in liver transplant recipients. J Clin Immunol 2002; 22: 381-5 Wysocki CA, Panoskaltsis-Mortari A, Blazar BR, Serody JS: Leukocyte migration and graft-versus-host disease. Blood 2005; 105: 4191-9

More Related