1 / 16

Modern í metody analýzy genomu - anal ýza

Modern í metody analýzy genomu - anal ýza. Mgr. Nikola Tom. Brn o , 2.4 .201 4. Workflow. Raw sequence = fastq. Biological sequence Corresponding quality scores ASCII character ( fasta + qual , csfasta + csqual , sff ) @

dom
Download Presentation

Modern í metody analýzy genomu - anal ýza

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Moderní metody analýzy genomu- analýza Mgr. Nikola Tom Brno, 2.4.2014

  2. Workflow

  3. Raw sequence = fastq • Biological sequence • Corresponding quality scores • ASCII character • (fasta+ qual, csfasta + csqual, sff) @ SEQ_ID GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT + !''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

  4. FastQC

  5. Cutadapt • Adaptor trimming (miRNA) • Quality filtering • Length filtering

  6. Read mapping => SAM, BAM • Usually mapping reads on reference • miRNA - special case • Grouping and annotate against mirBase • DNA • BWA, Bowtie, Bfast, SHRiMPclc • RNA • TopHat(de novo splice aligner) • Commercial • CLC Genomics Workbench

  7. SAM

  8. Alignment

  9. Mapping, Coverage reports • Important checkout for lab protocol • Specificity of PCR • Normalization • Settings of variant calling threshold, CNV

  10. SNV and small InDel Calling • Coverage • Frequency • Base quality • !!! • Genomic context (homopolymers) • Nucleotide type • Position in read (errors at the read end) • Alignment errors

  11. CNV variations

  12. Structural variations • Mate-pair library • Long InDel • Translocation

  13. Annotating and filtering • Gene • Transcript • dbSNP • Regulation • Comparative genomics • Repeats • Functional • Gene ontology • miRNA targets • Etc.

More Related