Expressing Genetic Information

1. Expressing Genetic Information

2. Gene Expression • Decoding of genetic information contained in the nucleic acid sequence of DNA segments (genes) so as to direct the production of proteins. • Structural • Enzymes

3. Genetic Expression Flow Chart amino acids • Proteins • Polypeptide 50 or more amino acids long • Structural • Enzymes • RNA • mRNA • rRNA • tRNA DNA nucleus cytoplasm

5. DNA & RNA • DNA • Deoxyribose + phosphate + N-base A-T, G-C • RNA • Ribose + phosphate + N-base A-U, G-C

7. Messenger RNA (mRNA) • Temporary copy of a gene • Single stranded • Complementary to one of the two DNA strands

8. other proteins

9. Ribosomal RNA (rRNA) • Synthesize proteins from amino acids • Single stranded • Folded into tertiary structure • Combines with proteins to form a ribosomal unit • Two ribosomal units make one ribosome

11. Transfer RNA (tRNA) • Transports amino acids during protein synthesis • Folded into tertiary structure • Can carry an amino acid-charged • May not carry an amino acid-uncharged

12. tRNA Detail

13. tRNA 3-Dimensional View

14. RNA Interrelationships • rRNA (ribosomes) read strands of mRNA (RNA copies of DNA). • tRNA molecules carry amino acids to the ribosomes for protein synthesis.

15. Importance of Proteins • Structural • Make up cells structures or tissue • Keratin in hair and nails • Collagen in skin • Enzymes • Catalyze bio-chemical reactions • Lactase • Hormones • Maintain homeostasis via remote chemical control • Insulin • Cell receptors • Receive chemical signals from other cells • Regulatory proteins • Influence transcription of DNA • Controls gene expression

16. Protein Structure

17. Essential Amino Acids • All animals require 20 amino acids • 12 can be synthesized by normal human adults • 11 by human infants • 8 (essential) amino acids must be eaten • 9 are essential to infants

18. 8 Essential Amino Acids for Humans

19. The Genetic Code • DNA code • Base sequence divided into sets of three called triplets • e.g. ATG • mRNA copy is synthesized and leaves the nucleus • Transcription • E.g. UAC called a codon • Ribosomes (rRNA) “read” each codon, holding them in place • Charged tRNA molecules with the complementary anti codon pair with the mRNA codon • Translation • E.g. tRNA AUG pairs with mRNA UAC • tRNA AUG is charged with the amino acid tyrosine

20. Transcription & Translation

23. Hemoglobin

24. Tertiary structure of lysozyme Primary structure of lysozyme

26. Quiz: The Genetic Code TACGAGAATTCGCGTACCTGCGGGTATGTATTTTTCGTCGGATTGTCTCACCAATGAATT Directions: Translate the genetic code of the above DNA segment into a polypeptide. Use amino acid abbreviations only. List each abbreviation in order on the table provided.

27. Quiz: The Genetic Code TACGAGAATTCGCGTACCTGCGGGTATGTATTTTTCGTCGGATTGTCTCACCAATGAATT Directions: Translate the genetic code of the above DNA segment into a polypeptide. Use amino acid abbreviations only. List each abbreviation in order on the table provided.

28. Transcription (RNA Synthesis) • Takes place in the nucleus. • RNA polymerase unwinds DNA strands. • RNA polymerase makes an RNA complement of one of the two DNA strands. • Coding strand is the transcribed strand. • Non-coding strand serves as a template to produce another coding strand during DNA replication.

30. Transcription in Prokaryotes vs. Eukaryotes Eukaryotes Prokaryotes • More complex • 3 kinds of RNA polymerase • One for each kind of tRNA • Requires initiation factor proteins • Slower and multi stepped • Occurs inside the nucleus • RNA is modified inside the nucleus • Completed RNAs move out to the cytoplasm through nuclear pores • Nucleolus is the site of RNA synthesis • rRNA + 70 otherproteins • Simple • One kind of RNA polymerase • Occurs in the cytoplasm • Transcription and translation are rapid RNA polymerase joins RNA nucleotides into an RNA strand

31. Transcription in 3 Stages • Initiation • Elongation • Termination

32. Initiation • RNA polymerase attaches to the promoter region of the coding DNA strand • In eukaryotes, special proteins called initiation factors must be present for RNA polymerase to attach to the promoter region.

33. Elongation • RNA polymerase partially unwinds DNA. • RNA polymerase moves along the coding DNA strand, away from the promoter site. • The RNA produced is called a preliminary transcript.

34. Termination • RNA polymerase reaches the terminator region. • Transcription stops. • RNA polymerase and primary transcript are released.

35. RNA Processing • RNA primary transcripts average 5,000 nucleotides (can be up to 200,000). • Cytoplasmic RNA averaged 1,000 nucleotides. • Eukaryotic RNA is processed and edited before leaving the nucleus.

36. RNA Processing • mG Cap • Poly-A tail • Splicing

37. mG Cap • Methyl-guanine (mG) • Specially modified guanine nucleotide • “Caps off” the 5’ end of the mRNA transcript • Functions of mG cap • Protect 5’ end from enzymes that would break down the transcript • Acts as a ribosome attachment site

38. Poly-A Tail • Series of 150 to 200 adenine nucleotides. • An enzyme adds a poly-A tail to the 3’ end of an mRNA transcript. • 3’ end is the last to be transcribed • Function • Helps prevent enzymatic degradation like the mG cap. • Facilitates the movement of the transcript out of the nucleus.

39. Introns, Exons & Splicing • Introns • Internal primary mRNA transcripts that do not code for protein. • Splicing • Enzymes cut out introns and join the remaining exons. • Exons • The protein coding outer ends of an mRNA primary transcript.

40. processed mRNA

41. tRNA Processing • Splicing of tRNA primary transcripts lead to the specific 3-D folding of the molecule to create the 3 looped structure.

42. rRNA Processing • Splicing of rRNA primary transcripts produces mature, non-coding RNA. • Binds with protein to become ribosomal units. • 2 ribosomal units combine to form ribosomes. • Many ribosomes translating one mRNA is called a polyribosome.

43. Translation (Protein Synthesis) • Ribosomes build polypeptides based on the genetic code of a processed mRNA strand. • Translation between molecular languages • Between nucleic acid and amino acids • Translation • tRNA charging • Initiation • Elongation • Termination

44. tRNA Charging • The attachment of the correct amino acid to its tRNA molecule. • Amino acids bind to the “amino acid binding site. • Enzymes used to catalyze the reaction. • One molecule of ATP used to fuel the reaction. • The accuracy of protein synthesis depends on the accuracy of tRNA charging.

45. Initiation • Small and large ribosomal units come together at the start codon AUG. • tRNA UAC + Met attaches to the AUG codon and is held in place at the P site of the ribosome. • P stands for peptide site • Proteins called initiation factors are needed to bring all components together.

46. Elongation • Codon recognition • Peptide bond formation • Translocation

47. Codon Recognition • A second charged tRNA with the the anticodon complementary to the next mRNA codon fits into the A site on the ribosome. • A stands for amino acid site.

48. Peptide Bond Formation • A peptide bond is formed between Met and the adjacent amino acid. • The dipeptide is now attached to the A site tRNA.

49. Translocation • Ribosome moves one codon (3 bases) from the 5’ to 3’ along the mRNA molecule. • tRNA UAC (that once held Met is now in a third site on the ribosome called the E site and is released. • E for exit. • The second tRNA, now attached to the dipeptide moves from the A site to the P site. • The A site is now left vacant for the next incoming charged tRNA.

50. Termination • Stop codons do not code for any amino acid. • UAA, UAG, and UGA are stop codons. • No tRNA has anti codons to these three. • When a stop codon reaches the A site a release factor protein binds instead of a tRNA. • The ribosomal unit comes apart and the polypeptide is released.