1 / 5

atttgaaatgaaggcagaaaccaggcttaaacaaagactgaaactcattctcttttcaaa

Supplemental Results. atttgaaatgaaggcagaaaccaggcttaaacaaagactgaaactcattctcttttcaaa tctcctgccgataaacatatgtgcccagtcttttgtttcccagacatcaggtttccatta tttaaacagagcttctacctggatctgtcaagagcatgaggcagacatatttaagatttt tacaaaccggtgtatgagttaggtgagttttgcaaatgttcaaattcatttaatcaaaag

drake
Download Presentation

atttgaaatgaaggcagaaaccaggcttaaacaaagactgaaactcattctcttttcaaa

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Supplemental Results atttgaaatgaaggcagaaaccaggcttaaacaaagactgaaactcattctcttttcaaa tctcctgccgataaacatatgtgcccagtcttttgtttcccagacatcaggtttccatta tttaaacagagcttctacctggatctgtcaagagcatgaggcagacatatttaagatttt tacaaaccggtgtatgagttaggtgagttttgcaaatgttcaaattcatttaatcaaaag aagcgctacaatggtgtccttaatccttttatgattactgcaattttcagacaatatgaa caacacttattgcttctatatgctcttgtcttgtagcatttactttaatatcagtggaca gacagatatcactagtcatctgctgtttcttgagacatttgtaattttgtactctggtac acttctctctccttgttctactgaaccccatacttacctacgaaaatactaagaacaaac atatgtattcctctgcttgcagcttgggaggcattatttattcaaatgacccaaagcttt taaagtcaatcttcaagttaaaaataaaaaaaaatggtactaccaatgtaccacgccctg cttccttgaagaataggattcaggggaatcattgtaattgcacatctctttgttgtgttgt gggttgcttggttatcagcactaactgcagaaaatttcacgattctatatttctcttccc tgctttctgttttgctaatacattaaaaaaagaacacttttgcttgcatagcaaactttc ttcttctttgactcttttgcaatagcttgttaactgtccataacgaagactgtctgtaaa tgctgtatgtatcctctttgctgaacaaaaggtgaaacaaaaggatcagcaagcagggta gagattaaaacatatgagtcctggcaagagtttacttttgttgaaattcacatgtcctca taacagctatgggccccttgggaatttatttaaaatctgtcaccctgtgtttcctgaatc gtagattggcaataatattaatactttttagggcatgcgctgtgtgttaggcatcatttt cagtactctaaatataataattcatttgcttttagtaacttcatgatatgagtaactaat atccccatttctcagatgagaaagcagagacaagaagaaggcaagtcatgtgactccatt catagaactgagatgtggcttgtgaagccaagtgtttggccttcagaggccattgcttac cacttgctatggtgctctctgttgatctactgagcacacagtacttagtacaccattagg cacggagcacctgctgtcagctggtactgtccagtaccatcacctcgtatggactcatc catttttattttattttattttattttttttgctgctgctggctggtatgaaggggattgt tcttccacagaaaaggaaaaacagtcataacaatagcagcataatcatcctttaccttgt ctggtgtatatttgagctacagttgtgacagtcacatgaaaaagggcactacatggaact ttatttttgtcgtgacaaaattttatccttcttatcctcaaccttctagcagcagggcaa ctgaccaaaatggttcaaagtaaggtaaaaacttaaaagtcacagacgtcaagtagaatt gctaccattctttaataaacaatgttaaaaaatttaaaatgtactgaaagctgtaaaaga tgcttgtgaaccaactttgtactctttctagtccttaactgattttagaaagccaggatc agaaaaatagaaaaaaattctgctaaaaattatattcttctcttaaagaaagccacggag tttaaaactctctaacacatttgtggaaactttattttttttttgtttgagatttatttg aatgagctgttatgattggagacatgagaatttcagattaatgttttgcagccagaaaaa aaagccctctggaaagctggcaagtgttcataagtcagctccagaattatgtaggttgaa Ggctccccagtggacagagcgaatatataagaaggaaaccagaggtctggtgc agttaca Tcccagagtct ggggatggagcgagcacagaatt GRE1 GRE2 GRE3 GRE4 GRE5 GRE6 GRE7 GRE8 +1 Figure S1. Rat AT2R gene promoter sequence. The TATAA element is labeled in red. GREs are labeled in blue.

  2. CGRE+NE+C-CGRE AGRE+NE+C-AGRE 4+NE+C-CGRE 4+NE+C-AGRE 6+NE+C-AGRE 6+NE+C-CGRE 4+NE+C-4 AGRE+NE CGRE+NE 6+NE+C-6 6+NE 4+NE 6+NE 4+NE 4 6 GRE oligos used in EMSA GRE 1 (-1853) 5’- CTACAATGGTGTCCTTAATCCTTTTA GRE 2 (-1674) 5’-TCTCTCTCCTTGTTCTACTGAACCCC GRE 3 (-1526) 5’-GTACTACCAATGTACCACGCCCTGCT GRE 4 (-1159) 5’-GAAATTCACATGTCCTCATAACAGCT GRE 5 (-947) 5’-TGAGAAAGCAGAGACAAGAAGAAGGC GRE 6 (-676) 5’-ATGAAGGGGATTGTTCTTCCACAGAA GRE 7 (-107) 5’-AGCTGGCAAGTGTTCATAAGTCAGCT GRE 8 (+13) 5’-GGATGGAGCGAGCACAGAATTGAAAG    Consensus GRE oligos used for heterologous competition in EMSA CGRE-S 5’-TATGGTTACAAACTGTTCTAAAAC CGRE-AS 5’-GTTTTAGAACAGTTTGTAACCATA AT1a-GRE-S 5’-AAGCTTGTACACTATTGTCTGAGTT AT1a-GRE-AS 5’-AACTCAGACAATAGTGTACAAGCTT 8+NE+C-AGRE 5+NE+C-CGRE 7+NE+C-AGRE 5+NE+C-AGRE 8+NE+C-CGRE 7+NE+C-CGRE 3+NE+C-AGRE 3+NE+C-3 3+NE+C-CGRE 1+NE+C-CGRE 2+NE+C-CGRE 8+NE 5+NE 6+NE 3+NE 1+NE 2+NE 6+NE 6+NE 7+NE    Figure S2. Characterization of GREs in the AT2R promoter. EMSA was performed with nuclear extracts (NE) and biotin labeled ds-oligo probes containing GREs (1 through 8), and consensus GRE (CGRE), AT1aR-GRE (AGRE). C-3, C-4, C-6, C-CGRE, C-AGRE etc are cold ds-oligos used for competition experiments. Each EMSA generated band of same electrophoretic mobility as those of authentic GREs CGRE and AGRE, and competed out by homologous, heterlogous, and consensus oligos.

  3. Figure S3. Effect of dexamethasone (Dex) on AT2R protein and mRNA abundance. Intact 17-dayfetal hearts were treated with Dex for 48 hours in the absence or presence of RU 486. Data are mean  SEM. * P < 0.05 (t-test), treatment vs. control. n = 6.

  4. Male Female Figure S4. Effect of AT1R and AT2R inhibitors on cardiac ischemia and reperfusion injury. Hearts were isolated from 3 month old male and female rats and were pretreated in the absence or presence of losartan (1 μM), or PD123,319 (PD, 0.3 μM), or losartan + PD for 5 min before subjecting to 20 min of ischemia and 30 min of reperfusion in a Langendorff preparation. Post-ischemic recoveries of left ventricle dP/dtmax, dP/dtmin, and end diastolic pressure (LVEDP) were determined. Data are mean  SEM. * P < 0.05 (2-way ANOVA), treatment vs. control. n = 5.

  5. Figure S5. Rescue effect of PD123,319 on hypoxia-mediated ischemic vulnerability. Hearts were isolated from 3 month old male offspring that had been exposed to normoxia (control) or hypoxia before birth, and were treated in the absence or presence of PD123,319(0.3 μM) for 5 min before subjecting to 20 min of ischemia and 30 min of reperfusion in a Langendorff preparation. Post-ischemic recovery of dP/dtmax and dP/dtmin were determined. Data are mean  SEM. Data were analyzed by two-way ANOVA.* P<0.05, hypoxia vs. control; † P<0.05, +PD123,319 vs. -PD123,319. n = 5

More Related