1 / 44

The Age of Things: Sticks, Stones and the Universe

The Age of Things: Sticks, Stones and the Universe. Molecular Dating and the Many Kinds of Mammals. http://cfcp.uchicago.edu/~mmhedman/compton1.html. Proconsul. WARNING! Astrophysicist talking about Mammalian Phylogeny!. Non-Placental Mammals. Marsupials. Monotremes. Rodentia.

dunn
Download Presentation

The Age of Things: Sticks, Stones and the Universe

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. The Age of Things:Sticks, Stones and the Universe Molecular Dating and the Many Kinds of Mammals http://cfcp.uchicago.edu/~mmhedman/compton1.html

  2. Proconsul

  3. WARNING! Astrophysicist talking about Mammalian Phylogeny!

  4. Non-Placental Mammals Marsupials Monotremes

  5. Rodentia

  6. Lagomorpha

  7. Chiroptera

  8. Carnivora

  9. Primates

  10. Cetacea

  11. Atriodactyla

  12. Perissodactlya

  13. Xenarthra

  14. Hyracoidea Sirenia Proboscidea Dermoptera Tubilentata Pholidota

  15. Insectivora Scandentia Macroscelidea

  16. Fossil Records of the Different Orders

  17. Relationships between the orders derived from morphological characteristics

  18. Perhaps orders arose rapidly when the dinosaurs died out

  19. Molecular Data Sloth TGCCAAATTAGTTCCGTCATGAGAATGGACTACATGGTCTACTTCAGTTT Hedgehog TGCCAATTCCGTTCTGTTGTGAGAATGGACTACATGGTGTTCTTCAGCTT Sirenian TGCCAATTCCGTTCCGTTATGAAGATGGACTACATGGTCTACTTCAGCTT Elephant TGCCAATTCCGTTCCGTTATGAGGATGGACTACATGGTCTACTTCAGCTT Aardvark TGCCAATTCCGTTCCGTTATGAGGATGGACTACATGGTCTACTTCAGCTT Mouse TGCCACTTCCGTTCCGTGGTCAGTTTGGATTACATGGTCTTCTTCAGCTT Rabbit TGCAAATTCGATTCTGTTATACCCATGGAATACATGGTCTTCTTTAGCTT Human TGCCAATTTGTTTCCGTCATGAGAATGGTCTACATGGTATACTTCAGCTT Flying Fox TGCCAATTCCGTTCTGTCATAAAGATGGACTACATGGTCTATTTCAGCTT Whale TGCCAATTCCGTTCCGTCATGAGGATGGACTACATGGTCTACTTCAGCTT Pig TGCCAGTTCCGTCATGAGGATGGACTGGACTACATGGTCTACTTCAGCTT Horse TGCCAATTCCGTTCTGTTGTGAGCATGGACTACATGGTCTACTTCAGCTT Cat TGCCAGTTCCGTTCTGTCATGACGATGGACTACATGGTCTACTTCAGCTT

  20. Chimp Gorilla Orangutan Human 1.24% 1.62% 3.08% Chimp 1.63% 3.12% Gorilla 3.09% Human Chimp Gorilla Orangutan

  21. All animals do not accumulate mutations at the same rate

  22. W X Y Z Time 2 10 Mutations 10 Mutations 30 Mutations 30 Mutations Time 1 5 Mutations 5 Mutations Time 0

  23. X Y Z W 40 50 70 X 30 50 Y 40 W X Y Z Time 2 10 Mutations 10 Mutations 30 Mutations 30 Mutations Time 1 5 Mutations 5 Mutations Time 0

  24. X Y Z W 40 50 70 X 30 50 Y 40 W X Y Z Time 2 10 Mutations 10 Mutations 30 Mutations 30 Mutations Time 1 5 Mutations 5 Mutations Time 0

  25. X Y Z W 40 50 70 X 30 50 Y 40 W X Y Z Time 2 10 Mutations 10 Mutations 30 Mutations 30 Mutations Time 1 5 Mutations 5 Mutations Time 0

  26. X Y Z W 40 50 70 X 30 50 Y 40 W X Y Z Time 2 10 Mutations 10 Mutations 30 Mutations 30 Mutations Time 1 5 Mutations 5 Mutations Time 0

  27. X Y Z W 40 50 70 X 30 50 Y 40 W X Y Z Time 2 10 Mutations 10 Mutations 30 Mutations 30 Mutations Accumulates More Mutations Time 1 5 Mutations 5 Mutations Time 0

  28. X Y Z W 40 50 70 X 30 50 Y 40 W X Y Z Time 2 10 Mutations 10 Mutations 30 Mutations 30 Mutations Time 1 Accumulates More Mutations 5 Mutations 5 Mutations Time 0

  29. X Y Z W 40 50 70 X 30 50 Y 40 W X Y Z Time 2 10 Mutations 10 Mutations 30 Mutations 30 Mutations Time 1 5 Mutations 5 Mutations Time 0

  30. Tree Based on Morphological Characters Tree Based on Molecular Characters

  31. Afrotheria Xenartha Euarchonotoglires Laurasiatheria

  32. Proconsul Sivapithecus Calibrating the molecular clock Human Chimp Gorilla Orangutan 1% 5 Millions of years ago 10 2% Sivapithecus 3% 15 Proconsul

  33. X Y Z W 40 50 70 X 30 50 Y 40 W X Y Z Time 2 10 Mutations 10 Mutations 30 Mutations 30 Mutations Time 1 5 Mutations 5 Mutations Time 0

  34. X Y Z W 40 50 70 X 30 50 Y 40 W X Y Z Time 2 10 Mutations 10 Mutations 30 Mutations 30 Mutations Time 1 5 Mutations 5 Mutations Time 0

  35. A simpler problem: Flipping Coins Probability of getting five heads, given the number of Coin Flips

  36. A simpler problem: Flipping Coins Probability of getting five heads, given the number of Coin Flips Assumed Probability of each number of Coin Flips

  37. A simpler problem: Flipping Coins Probability of getting five heads, given the number of Coin Flips Assumed Probability of each number of Coin Flips Likelihood the coin was flipped a given number of times

  38. 120 Million Years Ago Eutherians

  39. 105 Million Years Ago Afrotheria Eutherians Xenarthra and others

  40. 90 Million Years Ago Euarchontoglires Laurasiatheria ? Afrotheria Xenarthra

  41. Next Time Meteorites and the Age of the Solar System

More Related