Protein Synthesis Making Proteins

1. Protein Synthesis Making Proteins

2. Cell organization • DNA • DNA is in the nucleus • genes = instructions for making proteins • want to keep it there = protected in the nucleus • “locked in the vault” cytoplasm nucleus

3. nucleus Cell organization • Proteins • chains of amino acids • made by a “protein factory” or ribosome in cytoplasm • Rough ER protein for export, free ribosome Protein for cell • protein factory = ribosome cytoplasm buildproteins ribosome

4. nucleus Passing on DNA information • Need to get DNA gene information from nucleus to cytoplasm • need a copy of DNA • messenger RNA (mRNA) is made from DNA • mRNA can leave the nucleus cytoplasm buildproteins mRNA ribosome

6. RNA Translation: Protein Synthesis • http://www.biologyjunction.com/ANIMPROT.htm

7. From nucleus to cytoplasm transcription Ribosome protein DNA mRNA translation trait nucleus cytoplasm

8. DNA deoxyribose sugar nitrogen bases G, C, A, T T : A C : G double stranded RNA ribose sugar nitrogen bases G, C, A, U U : A C : G single stranded DNA vs. RNA

9. Transcription • Making mRNA from DNA • DNA strand is the template (pattern) • pairing bases • U : A • G : C • Enzyme • RNA polymerase

10. Pairing bases of DNA & RNA • Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T

11. Pairing bases of DNA & RNA • Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T

12. RNA polymerase Pairing bases of DNA & RNA A • Pair RNA bases to DNA bases on one of the DNA strands C U G A G G U C U U G C A C A U A G A C U A G C C A T G G T A C A G C T A G T C A T C G T A C C G T

13. ribosome A C C A U G U C G A U C A G U A G C A U G G C A Pairing bases of DNA & RNA • U instead of T is matched to A TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA

14. ribosome A C C A U G U C G A U C A G U A G C A U G G C A cytoplasm protein nucleus trait

15. mRNA A C C A U G U C G A U C A G U A G C A U G G C A aa aa aa aa aa aa aa aa How does mRNA code for proteins • mRNA leaves nucleus • mRNA goes to ribosomes in cytoplasm • Proteins built from instructions on mRNA

16. ribosome TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA MetArgValAsnAlaCysAla protein ? aa aa aa aa aa aa aa aa How does mRNA code for proteins? How can you code for 20 amino acids withonly 4 DNA bases (A,U,G,C)?

17. ribosome TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg ValAsnAlaCys Ala protein ? mRNA codes for proteins in triplets • Codon = block of 3 mRNA bases

18. The mRNA code • For ALL life! • strongest support for a common origin for all life • Code has duplicates • several codons for each amino acid • mutation insurance! • Start codon • AUG • methionine • Stop codons • UGA, UAA, UAG

19. GCA CAU UAC tRNA Met Arg Val How are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA mRNA AUGCGUGUAAAUGCAUGCGCC codon anti-codon aminoacid • Anti-codon = block of 3 tRNA bases

20. ribosome mRNA A C C A U G U C G A U C A G U A G C A U G G C A U A C G G U tRNA tRNA A G aa U A G tRNA aa aa aa tRNA aa aa mRNA to protein = Translation • The working instructions  mRNA • The reader  ribosome • The transporter  transfer RNA (tRNA) C

21. aa ribosome aa aa aa A C C A U G U C G A U C A G U A G C A U G G C A aa aa aa _______ aa From gene to RNA to protein _____________ _________________ ______________ __________ ______ ______ _____________ trait

22. aa ribosome aa aa aa A C C A U G U C G A U C A G U A G C A U G G C A aa aa aa tRNA aa From gene to RNA to protein cytoplasm transcription translation protein DNA mRNA trait nucleus

23. cytoplasm protein transcription translation nucleus trait

24. From gene to protein protein transcription translation