The Science of DNA Analysis

1. DAY 2: The Science of DNA Analysis DNA FINGERPRINTING

2. Although more than 99% of DNA is identical in all humans, the remaining 1% is different for every individual. It is this less than 1% that is used in DNA profiling.

3. A segment of DNA, or gene, contains the instructions for building a particular protein. All individuals have 2 alleles for a particular gene, one that is inherited from each parent.

4. What is an ALLELE? • An allele is one of two or more alternative forms of a single gene that can exist at the same locus, or location, on a chromosome. All the alleles of a gene determine the same hereditary trait, but each has a unique nucleotide sequence, which may result in different physical and physiological characteristics or phenotypes.

5. To demonstrate the differences in the less than 1% of DNA used for profiling, we will examine D13S317, a locus on chromosome 13.

6. D13S317 has 9 common forms of the repeated sequence, TATC. A repeated sequence is known as a short tandem repeat or STR. Every individual will have some combination of 2 of the following alleles: • 7 repeated units of TATC, indicated as TATCTATCTATCTATCTATCTATCTATC • 8 repeated units of TATC, indicated as TATCTATCTATCTATCTATCTATCTATCTATC • 9 repeated units of TATC, etc. up to 15 repeated units.

7. Because an individual can have any combination of alleles, one person may have an allele with 9 repeats and the other with 15 repeats, stated as 9, 15. Another could have 7 repeats on both alleles stated as 7, 7.

8. DNA can be recovered from bodily fluids such as saliva, blood and semen; tissues, hair, bones and teeth for analysis in a lab.

9. In 1997, the FBI established CODIS, the Combined DNA Index System, a national computer database in which DNA profiles can be entered and compared to others on file. Thirteen selected loci, such as the D13S317 one used in the previous example, form this national database.

10. THE ODDS OF ANOTHER HUMAN BEING HAVING YOUR EXACT DNA ARE ESTIMATED TO BE 1 in 7.7 Quadrillion or 1 in 7,700,000,000,000,000

11. Steps in STR Analysis Step 1:DNA Collection • At the crime scene, samples (blood, tissues, saliva, skin) containing DNA must be carefully collected so as not to contaminate them with outside DNA.

12. Step 2:DNA Extraction • Once back in the laboratory, the DNA is released from cells, purified and isolated in solution.

13. Step 3:DNA Amplification • Because DNA is very small, the amount obtained from the crime scene must be increased, or amplified, using a special process called polymerase chain reaction or PCR. • This process can be equated with taking an original in excellent condition and running thousands of copies on a good quality copier.

14. Step 4:DNA Analysis • The amplified DNA is now ready to analyze. Two methods of DNA analysis will be discussed: the STR analysis method and gel electrophoresis.

15. STR Analysis • STR analysis continues with the injection of the DNA amplified by PCR into a computerized machine. A focused beam of light is then passed through the sample. From the information obtained, a graph is generated indicating the number of repeats for each STR.

16. Table 1: example of STR frequencies for a typical white male.

17. While it is routine to examine 13 different loci, only 3 will be examined here. They are STR locus D3S1358 on chromosome 3, vWA on chromosome 12, and FGA on chromosome 4. Figure 1 shows an STR analysis of 3 DNA markers for 5 individuals. The first group of peaks indicates the 8 most common forms of the D3S1358 locus, the second grouping shows the 11 most common forms of vWA, and the third group represents the 14 most common forms of FGA. These are the reference peaks against which samples from our 5 individual’s will be compared.

18. Figure 1 The DNA of 5 individuals is analyzed using STR. Any DNA evidence retrieved from the crime scene would also be analyzed at the same time. If the DNA from the crime scene showed 15 & 18 repeats at the D3S1358 locus, who would the police charge with the crime?

19. Answer: John’s DNA is the only one that matches that chromosome marker.

20. Table 2: results from an STR analysis

21. Using the DNA evidence profiles from Table 2, who committed the crime? Why did you choose that person?

22. Answer • Point #1: When a blood stain is from a single source, only 2 alleles would be present. In our sample there are 3, indicating that the stain contains DNA from 2 people. • Point #2: The blood stains indicate that only male DNA is present, thus suspect #2 can be ruled out.

23. Point #3: Suspect #3 has 2 markers that match the DNA samples found on the knife and bloody clothing but no matches at D3, 21, 18, 5, 7, FGA and vWA. • Point #4: Both Suspect #1 and the victim’s blood are on the knife and clothing. Suspect #1 is also the only person to match all 9 markers. Therefore, Suspect #1 is guilty.

24. Can you solve, The Case of the False Conviction? • Objective: Use the DNA Evidence Profile provided to prove innocence • The accused: Jason Roberts • The case: Wrongful conviction

25. July 30, 2007. Atlanta, Georgia. Police respond to a 911 call made by Helen Slater, the victim’s daughter. Upon arriving, they discover the body of an elderly man, Sam Elliott, in the back room of his goldsmith shop. The motive appears to be robbery. One of the suspects, Jason Roberts, has a prior criminal record for burglary and assault. The victim’s daughter also provided the name of a disgruntled ex-employee, Henry Darrow.

26. The investigators are able to recover three useful sets of fingerprints: those of the victim, the daughter, and Jason Roberts. They also tag several articles found at the crime scene: a large cloth bandana, a coat, an awl, and a wooden mallet thought to be the murder weapon. Upon questioning, Darrow is found to have a hand injury he claims was the result of a wood chopping accident. Jason Roberts is immediately picked up by the police and charged with the murder. He claims he is innocent.

27. Using Table 3, answer the following questions: • Q1). Compare the alleles for each of the 4 people as well as those found on the bandana, mallet, awl and coat. Which ones match? • Q2). Can any of the suspects be eliminated? If so why? • Q3). Can the awl be linked to the crime? • Q4). Can the alleged murder weapon be linked to any suspect? The victim? • Q5). Are there any blood stains with DNA from more than one person? If so on which articles? • Q6). Who murdered Sam Elliott?

28. Table 3: results from the STR analysis of the DNA samples from the crime scene.

29. Using Table 3, answer the following questions: • Q1). Compare the alleles for each of the 4 people as well as those found on the bandana, mallet, awl and coat. Which ones match? • A1). The mallet, bandana and awl are contaminated with Darrow’s blood. The mallet also has blood from the victim. The coat has only the victim’s blood on it. • Q2). Can any of the suspects be eliminated? If so why? • A2). The daughter, Helen Slater can be eliminated. None of the articles are contaminated with her blood, nor do they indicate the presence of female DNA. Jason Roberts can also be eliminated as his blood does not appear on any of the articles collected from the crime scene.

30. Q3). Can the awl be linked to the crime? • A3). Yes. The awl has Darrow’s blood on it. • Q4). Can the alleged murder weapon be linked to any suspect? The victim? • A4). Yes, to Darrow. It also has the victim’s blood on it indicating that is was the murder weapon. • Q5). Are there any blood stains with DNA from more than one person? If so on which articles? • A5). Yes. The mallet has blood from both Darrow and the victim. • Q6). Who murdered Sam Elliott? • A6). Henry Darrow.

31. Gel Electrophoresis

32. Remember that most alleles useful for DNA fingerprinting differ on the number of repetitive base sequences they contain. Restriction enzymes are used to cut the DNA along these repetitive sequences.

33. If DNA is cut at points shown by the arrows with a restriction enzyme that recognizes sites on either side of the region that varies, DNA fragments of different sizes will be produced.

34. DNA fragments are then separated based on size using gel electrophoresis.

35. A DNA fingerprint is made by analyzing the different sizes of DNA fragments produced from a number of different sites that vary within the genome. In a standard DNA fingerprint, as many as a dozen sites can be analyzed with each site having many possible combinations of alleles.

36. To run your own gel electrophoresis, visit the Gel Electrophoresis Virtual Lab athttp://learn.genetics.utah.edu/units/biotech/gel/

37. http://www.pbs.org/wgbh/nova/sheppard/analyze.html • Go to the website above • Objectives: gain experience working with DNA fingerprinting and gel electrophoresis • Read the introduction to “Create a DNA Fingerprint” • Scroll down and click on Part 1: It Takes a Lickin’. What crime was committed and what evidence will be used to solve it?

38. Click on Part 2: DNA Fingerprinting at the NOVA Lab. List the 8 steps involved in creating a DNA fingerprint • Answer the following questions: • What does a restriction enzyme do? • What is the difference between the individuals that you are going to analyze? • What is agarose gel and why is it being used? • Where is the DNA placed in the agarose gel? • Why is an electric current needed for electrophoreis?

39. What size DNA fragment moves the farthest along the gel? • Why is a nylon membrane placed over the gel? What happened to the DNA? • What are probes and what do they do when placed on the nylon membrane? • What happens to the probes that do not bind to DNA? • How do the probes and x-ray film work together? • What caused the lines to appear on the x-ray and what is this called?

40. Click on Part 3: Evaluate the Evidence • Who is the culprit? Now visit: Primary Science-Crime Scene Investigation 3-DNA at http://www.teachers.tv/video/21986 for a 15 minute video References: • Rainis, Kenneth, G. 2006. Blood and DNA Evidence. Enslow Publishers, Inc. • http://www.pbs.org/wgbh/nova/sheppard/analyze.html • http://learn.genetics.utah.edu/units/biotech/gel/