1 / 13

Whole Genome Polymorphism Analysis of Regulatory Elements in Breast Cancer

Whole Genome Polymorphism Analysis of Regulatory Elements in Breast Cancer . Jacob Biesinger Dr. Garry Larson City of Hope. AAGTCGGTGATGATTGGGACTGCTCT [C/T] AACACAAGCGAGATGAAGAAACTGA. Topics Covered Today. Cancer and Gene Regulation Combining Data: Bioinformatics Progress So Far.

esma
Download Presentation

Whole Genome Polymorphism Analysis of Regulatory Elements in Breast Cancer

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Whole Genome Polymorphism Analysis of Regulatory Elements in Breast Cancer Jacob BiesingerDr. Garry LarsonCity of Hope AAGTCGGTGATGATTGGGACTGCTCT[C/T]AACACAAGCGAGATGAAGAAACTGA

  2. Topics Covered Today • Cancer and Gene Regulation • Combining Data: Bioinformatics • Progress So Far • Molecular Cause of Genetic Disease

  3. TGTAGA Protein Coding Region Untranslated region • http://medicine.osu.edu/lend/Portfolios/0506/AR Port/files/SICKLE CELL WEBSITE/whatissickle.htm Single Nucleotide Polymorphisms and Genetic Disease • SNPs in coding regions: • Genetic disease may also be caused by differential expression of vital proteins Phe Phe Pro Pro Glu Val Ser Ser Thr Thr STOP STOP ATGCCGGCTTACCATA T A TCTACCTAAATCCGGT Sickle Cell Anemia Promoter Binding Mechanism ATGCCGGCTTACCATA A T TCTACCTAAATCCGGT Micro RNA Binding Mechanism Chunky sheep from miRNA binding site destruction Nature Rev. Genet. 5, 202–212 (2004)

  4. Breast Cancer Expression Normal Breast Expression Breast Tumor Expression • Tumor expression patterns are extremely divergent from normal cells • Could SNPs in regulatory regions of genes associated with breast cancer explain their overexpression in tumors? http://genome-www.stanford.edu/breast_cancer/cell_line_review2001/images/figure2.html

  5. Statistical Search for Dysregulated Genes • Expression patterns in cancers gives two categories: Estrogen Receptor + and ER- • Recent metaanalysis pooled tumor expression data for 9 studies and >15,000 genes • Top 1% ER+ > ER- 150 genes • Top 1% ER+ < ER- 150 genes Consistency across studies Normalized expression difference between ER+ and ER-

  6. vs. Regulation Motifs • Which TF binding sites exist in our selected genes? • A recent study identified motifs conserved in regulatory regions across 4 organisms lymphocyte transmembrane adaptor 1 Promoter motifs: • 123 known motifs • 174 phylogenetically conserved Downstream motifs: • 273 conserved 3’ UTR • 343 conserved miRNA 6mer • 368 conserved miRNA 7mer

  7. Motif Search • Use Python and UCSC Genome Browser to: • Get promoter region DNA (2kb upstream from transcription start site (TSS) + max of 2kb downstream of TSS, limited by translation start) • Get 3’ untranslated region RNA • Search for motifs on + and – strand • Results for Top 1% up and down: • 22206 known motif hits • 23475 phylo motif hits • 9559 3’ UTR hits • 42846 6mer hits • 11719 7mer hits

  8. SNP Databases HapMap ~4 million CGEMS ~550k • SNP information is coming from two databases: • HapMap- Four groups (270 total people) genotyped for same SNPs • CGEMS- Breast Cancer association study, complete with p-values. A late-comer to our study (June 2007)

  9. Mapping SNPs HapMap ~4 million Gene Promoters and 3’ UTR CGEMS ~550k • Use MSSQL 2003 and Python (pymssql) to perform a join of dbSNP, HapMap and CGEMS SNPs with regulatory motifs Motif Matches

  10. Verify Motif Significance • How do we know that these motifs are significant? Hypothesis: Due to negative selection, there will be fewer SNPs in motifs than in random areas within the same region. Method: Contrast how many motifs have at least one SNP in them against how many of 100 random sequences from the same region have at least one SNP in them

  11. Motif Counting Results • 3’ UTR results not yet available • There is a significant difference between motifs and random sequences.

  12. CGEMS Results • A number of SNPs that fall within motifs are associated with Breast Cancer • Highest ranking was 1514 out of 550,000 • Further analysis required to say if significant

  13. Thanks! • SoCalBSI mentors • City of Hope • Dr. Garry Larson • Dr. David Smith • Dr. Päl Sætrom • Cathryn Lundberg • All the SoCalBSI students! Funded by:

More Related