1 / 19

J.W. Love 1 C.M. Taylor 1 A.P. Rooney 2 M.L. Warren, Jr. 3

Population structure of Lepomis megalotis in seasonally fragmented streams: inferences from a nested cladistic analysis. J.W. Love 1 C.M. Taylor 1 A.P. Rooney 2 M.L. Warren, Jr. 3. 1 Mississippi State University, Department of Biological Sciences 2 U.S.D.A. Agricultural Research Service

euclid
Download Presentation

J.W. Love 1 C.M. Taylor 1 A.P. Rooney 2 M.L. Warren, Jr. 3

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Population structure of Lepomis megalotis in seasonally fragmented streams: inferences from a nested cladistic analysis J.W. Love1 C.M. Taylor1 A.P. Rooney2 M.L. Warren, Jr.3 1 Mississippi State University, Department of Biological Sciences 2 U.S.D.A. Agricultural Research Service 3 U.S.D.A. Forest Service, Oxford, MS

  2. Objectives • Identify population fragmentation for Lepomis megalotis (longear sunfish) in seasonally fragmented streams • Characterize gene flow among fragmented subpopulations

  3. Life History Characteristics • Gene flow influenced by dispersal capability (Zimmerman 1987) • Limited dispersal (Hasler and Wisby 1954; Berra and Gunning 1972) • Restricted movement paradigm (RMP; Gowan et al. 1994) • Relatively high immigration rate among pools in study area (I = 0.35; Taylor and Warren 2001) Lepomis megalotis (longear sunfish)

  4. Turner Falls Lake Sylvia Possible Causes of Population Fragmentation Colorado River

  5. Study Area

  6. Objectives • Identify population fragmentation • Fragmentation related to seasonal (i.e., local) and permanent (i.e., regional) barriers to gene flow • Differentiation between subpopulations related to stream distance between them • Differentiation related to extinction of rare haplotypes (September sampling) • Characterize gene flow among fragmented subpopulations • Overall pattern of restricted gene flow consistent with the RMP

  7. Haplotype Determination: D-Loop, mtDNA

  8. Sequence Determination: Unique Haplotypes CAATTAAAGATTTTTTGGATTGCCCTATGAATTATTTGGAAAATGCCACAAATATTAAATATTTAGTTAGACTGT CAATTAAAGATTTTTTGGATTGCCCTATAAATTATTTGGAAAATGCCACAAATATTAAATATTTAGTAAGACTGT CGATTAAAGATTTTTTGGATTGCCCTATAAATTATTTGGAAAATGCCACAAATATTAAATATTTAGTTAGACTGT CGATTAAAGATTTTTTGGATTGCCCTATAAATTAATTGGAAAATGCCACAAATATTAAATATTTAGTAAGACTGT CGACTAAAGATTTTTTGGATTGCCCTATAAATTAATTGGAAAATGCCACAAATATTAAATATGTAGTAAGACTGT CAATTAAGGGTTCTTTAAATCACTCTATAAATTAATTAAAAAATACCACAAACACTAAACATATAATAAGATTAT CAATTAAAGATTCTTTAAATTGCTCTACAAACTAATAAAAAAATATCACAAACACTAAACATATAATGAGACTAT CAATTAAAGATTCTTTAAATCACTCTATAAATTAATCAAAAAATACTACAAACACTAAACATATAATAAAATTAT GAATTAAAGATTCTTTAGATTACCCTATAAATTAATAAAAAAATACCACAAACACTAAACATATAATAAAACTGT AGTTATAAATGGAATCCATAATATAATACAAAATTTAAAAATGATTAATATATAATGGTATGTCATCTGTCATCCTAAAAGAATAGTTTACAATCTAGTGGGATGAGGGA AGTTATAAATGGAATCCATAATATAATACAAAATTTAAAAATGATTAATATATAATGGTATGTCATCTGTCATCCTAAAAGAATAGTTTACAATCTAGTGGGATGAGGGA AGTTATAAATGGAATCCATAATATAATACAAAATTTAAAAATGATTAATATATAGTGGTATGTCATCTGTCATCCTAAAAGAATAGTCTCCAATCTAGTGGGATGAGGGA AGTTATAAATGGAATCCATAATATAATACAAAATTTAAAAATGATTAATATATAATGGTATGTCATCTGTCATCCTAAAAGAATAGTTTACAATCTAGTGGGATGAGGGA AGTTATAAATGGAATCCATAATATAATACAAAATTTAAAAATGATTAATATATAATGGTATGTCATCTGTCATCCTAAAAGAATAGTTTACAATCTAGTGGGATGAGGGA AAGCATAAACAAAATACATAATATAATACGAAACTTAAAAACAATTAGTCTATAACGACACACCATCCGCCATCCTACATGAGTAGCCTATATTCTAATAGGATGAAGGA GACCATAAACAAAATCCATAGTATCGTACAAAATTTAAAAACAATTAGTCCATAACGACACACCCTCCGCCATCCTAAATGAATAGCCTACAATCTAATGGGATGAAGGA AACCACAAACAAAATACATAATATAATACAAAATTTAAAAACAATTAATTCATAACAACACACCATCCACCATCCTAAATGAATAACCTATATTCTAATATGATGAAGAA GATCATAAACAAAATACATAGTATAATACAAAATTTAAAAACAATTAGTTTATAACAATACATCATCTGCCGTTCTAAAAAAACATCCCACACCCCAATAAAATAAAAAA

  9. Population Fragmentation- AMOVA Results No Hierarchy % Var Φ-Statistic P Among sites 4.53 0.0453 0.0198 Within population 95.47 0.3744 2-region Hierarchy Between regions -1.32 ΦCT = -0.013 0.5918 Among sites 5.27 ΦSC = 0.0520 0.0203 within regions Within population 96.05 ΦST = 0.0394 0.0204 3-region Hierarchy Among regions -0.23 ΦCT = -0.0023 0.4743 Among sites 4.72 ΦSC = 0.0471 0.0392 within regions Within population 95.51 ΦST = 0.0448 0.0207

  10. Population Fragmentation- Isolation by Distance r2 = - 0.11 P = 0.68

  11. Population Fragmentation- Extinction L. megalotis F. olivaceus I. punctatus E. whipplei L. umbratalis L. megalotis F. olivaceus E. whipplei L. megalotis E. whipplei Haplo A Haplo B Haplo C Haplo D Haplo E Haplo A Haplo C Haplo E Haplo A Haplo C Extinction

  12. Population Fragmentation- Nested Subsets P [T < 14.35º] = 0.0375

  13. Characterizing Fragmentation- Haplotype Network

  14. Characterizing Fragmentation- Nested Cladistic Analysis Results Table 3. Inferences suggested by Templeton (1998) for results from a nested cladistic analysis. These inferences are based on significance tests from Figure. Clade Chain of inference Inference Haplotypes nested in 1, 2, 11, 12 Contiguous range expansion Clade 1-1 One-step clades nested 1, 2, 11, 12 Contiguous range expansion in 2-1 Two-step clades nested 1, 2, 3, 4, NO Restricted gene flow with in total cladogram isolation by distance

  15. Conclusions • Subpopulations of L. megalotis are significantly differentiated, but among region differences were less important than among site differences • Extinction processes influenced population fragmentation rather than geographic distance among sites • While L. megalotis exhibits restricted gene flow, long-range movement is probable and may contribute to recolonization of extirpated subpopulations

  16. Future Directions • Bayesian analyses? – Corander et al. 2003 • Bottleneck effects, particularly at a site? – Luikart et al. 1998 • Demographic history? – Skyline plots, Pybus et al. 2000

  17. Acknowledgements U.S.D.A. Forest Service Department of Biological Sciences (M.S.U.) Tom McElroy (Forest Products-M.S.U.) Anna Chromiack (LSBI-M.S.U.) Jim Grady (University of New Orleans) Karen Kandl (University of New Orleans) Kristine Oswald (M.S.U.) Jill Arnold (U.S.D.A.) Andy Sanders (M.S.U.)

More Related