What do you see?

1. What do you see? Colorblindness is an example of a sex-linked disorder

2. Human Genetics Chapter 14-1, 14-2 Human Heredity

3. The Human Genome ATGGGTCGCGTATCGTAGCTGATGGGGGTAGTATTTTATATGCTGGTAGACAAAACGGTGTACTGCCGTCGTCGTAGTGATGTGCGGCGCCAAAAATTATACTGTGACTGATCGTAGTGTAAAAAAAAAAGTCGTGCTGCTTTTTTCGATCGCGCGTAGTAGCTACGCCGCGGTTCGCGCGTAAGAGACTGATGCGACTGATATATATACGCGCTAGCATATATCTCTCGATCTGATCGTAGATGCTTAAGTTACTAGCTGTCGTATACGTAGTTAGTCGGGTGATGATGCTGTATATATCGCGCTCTATATGCTAGCTAGTGTTGTAGCTAGCTGATTCCCTCGAAGTCTCGTGAATAATCGCGCTTTCGGGGGCTCTCTATA

4. Human Genome • 3 billion base pairs • 6 billion individual bases • “4 million pages” • Bases (letters) spell out genes (words) that result in the phenotype (the story) • Some spell out bad stories (diseases)

5. Chromosome size source: International Human Genome Sequencing Consortium. Initial sequencing and analysis of the human genome. Nature 409:860-921(2001).Gene count source: Wellcome Trust. Unveiling your genome. Wellcome News Supplement Q1:13-23(2001).

7. Humans have 22 pairs of AUTOSOMESWhy is the 23rd pair different? What is it called?What is this picture called? When was this cell photographed?Is this a man or a woman? How do you know?

8. Answers… 2. The “23rd” pair are the sex chromosomes 3. This picture is a karyotype 4. It was taken during mitosis (likely metaphase) 5. It is a man • He has one X chromosome (larger) and one Y chromosome (smaller)

9. What do you see? Colorblindness is an example of a sex-linked disorder

10. h = hemophilia, a sex-linked disorder • For each, can you answer… • Is the dad affected? • Is the mom affected? • How many children have the disease? • How many children are carriers? • How many children are healthy? (careful!)

11. PEDIGREES  another way to study inheritance • What do you think the F1 generation (line II) # 2 and #5 offspring represent? • Can you draw the Punnett Square for the Parent generation? (I)

12. How to read a pedigree… Carrier female Carrier male

13. Pedigrees • Show how traits are passed down through many generations • Based mostly on phenotypes • Show the actual offspring • Punnett squares show the possible offspring • Really only works well for single traits • Not polygenic traits • Only works for inherited traits • Environmental factors play a large role in who we are

14. Inheriting Diseases • Just like physical traits, some diseases can be inherited on our chromosomes. • And, just like physical traits, some are X-linked, some are recessive, some are dominant or codominant.

15. Genetic Disorder Project topics Fragile x syndrome Gaucher disease Duschene Muscular Dystrophy Marfan syndrome Color blindness Hurler syndrome Tay-Sachs Albinism Cystic Fibrosis Sickle cell anemia PKU Lou Gehrig’s disease Cri du Chat syndrome Huntington Disease Turner’s syndrome Klinefelter syndrome Down syndrome Fanconi anemia

16. Other Chromosomal Actions • X-Inactivation  if men only need one X chromosome, do women need both X’s? • If not, which one “works”? • Non-disjunction  how gametes can end up with the wrong # of chromosomes in meiosis

17. X-Chromosome Inactivation • Men are XY: One X chromosome is enough • Women are XX: The “extra” copy is not needed. It condenses into a “Barr body.” • Remember, you have trillions of cells. Which X chromosome that “switches off” can vary in each cell!

18. Mosaicism

19. Nondisjunction • “Not coming apart” • Homologous chromosomes fail to separate in meiosis • Result in Trisomy or Monosomy • Examples: • Klinefelter syndrome (trisomy X) • Down syndrome (trisomy 21) • Turners syndrome (X_ monosomy)

20. Video 2 Video 2 • Click the image to play the video segment. Nondisjunction