1 / 12

Purpose

The expression of inflammatory cytokines in chemical- or microkeratome-assisted corneal epithelial flaps in rabbits. Taehyung Lim, MD 1,2,4 , Hyuk- Jin Choi MD 1,2 , Hyun Joo Lee 1,2 , Mee Kum Kim, MD 1,2 , Won Ryang Wee, MD 1,2 , Jin Hak Lee, 2,3

filipina-pawlak
Download Presentation

Purpose

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. The expression of inflammatory cytokines in chemical- or microkeratome-assisted corneal epithelial flaps in rabbits Taehyung Lim, MD1,2,4, Hyuk- Jin Choi MD1,2, Hyun Joo Lee1,2, Mee Kum Kim, MD1,2, Won Ryang Wee, MD1,2, Jin Hak Lee,2,3 Department of Ophthalmology, Seoul National University Hospital1, Seoul, Korea Seoul Artificial Eye Center, Seoul National University Hospital Clinical Research Institute2, Seoul, Korea Department of Ophthalmology, Bundang Seoul National University Hospital3, Seoul, Korea HanGil Eye Hospital4, Incheon, Korea Authors have not any financial support

  2. Purpose To compare the expression of inflammatory cytokines in chemical- or microkeratome-assisted corneal epithelial flaps in rabbit animal models.

  3. Subject & Methods • 40 eyes of 20 New Zealand White rabbits • Bilateral study • Corneal epithelial flap(diameter of 5.0 mm) was made using the following ways: • Group A ; 1. Application of 20% alcohol for 30 seconds, 2 or 3 times 2. Corneal epithelial flap was made using a micro hoe (Katena, U.S.) 3. The flap was replaced • Group B ; 1.The flap was made using epimicrokeratome(Amadeus,나라Hz) 2. The flap was replaced

  4. All the eyes wore therapeutic contact lenses and received tarsorrhaphies • Eyes were enucleated at 3 days after the procedure • Tissue sections were stained with H&E and immunohistochemistry (MMP-9, TNF-alpha) (hamster anti mouse TNF-alpha : Santa Cruz, sc-12744, mouse anti MMP-9, Chemicon, MAB3309) • IL-6, TNF-alpha were evaluated by RT-PCR and were compared between those two groups. (Rabbit TNF-a ; Forward PRIMER : atggtcaccctcagatcagc Reverse PRIMER : ttgaccgctgaagagaacct, Rabbit IL-6 ; Forward PRIMER : tcctggagaccatcaaggagReverse PRIMER : gggtggcttcttcattcaaa )

  5. Results • H&E stain showed more irregular arrangement of epithelial basal cells in Group A than in Group B Normal Group A Group B

  6. RT-PCR • - The expression level of mRNA of IL-6, MMP-9, TNF-alpha showed no significant difference between those two groups Mean ± SD

  7. Immunohistochemistry • MMP-9 Negative Control, x 200 Positive Control, x 200

  8. MMP-9 (x 200) Group A Group B

  9. Immunohistochemistry • TNF-alpha Negative Control, x 200 Positive Control, x 200

  10. TNF-alpha • (x400) Group A Group B

  11. MMP-9 and TNF-alpha were expressed and were more prominent than negative control tissue in all groups • There was no significant difference between two groups

  12. Conclusion • The expression of inflammatory cytokines in epimicrokeratome-assisted flap might be no different from alcohol-assisted flap, suggesting that the inflammatory response of the cornea might be similar between Epi-LASIK and LASEK.

More Related