1 / 26

Applied Developmental Biology Dr. Lubna Tahtamouni The Hashemite University 2010 Week # 2

Applied Developmental Biology Dr. Lubna Tahtamouni The Hashemite University 2010 Week # 2 Tools in Developmental Biology. 1. Questions to be answered in Dev. Bio.: axis determination (AP, DV, LR) *Q. how do you ‘break’ the symmetry of the egg? Sperm entry, localized determinants

flambert
Download Presentation

Applied Developmental Biology Dr. Lubna Tahtamouni The Hashemite University 2010 Week # 2

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Applied Developmental Biology Dr. Lubna Tahtamouni The Hashemite University 2010 Week # 2 Tools in Developmental Biology 1

  2. Questions to be answered in Dev. Bio.: axis determination (AP, DV, LR) *Q. how do you ‘break’ the symmetry of the egg? Sperm entry, localized determinants cell differentiation, cell proliferation, cell growth cell migration, polarization (symmetric vs asymmetric cell division), cell shape (giving cells different morphologies, e.g. neurons), cell death morphogenesis (how cells come together to form tissues; and how these tissues migrate) organogenesis timing (biological clock) 2

  3. Questions to be answered in Dev. Bio.: aging germ cell development, fertilization stem cells (what are they (multipotency, ability to self-renew), why did they become so ‘trendy’ (Dolly the sheep, 1997, showed that cloning was possible; development of human ES cells, 1998) regeneration - How efficient is human development? (talk about implantation) 3

  4. Developmental biology Model systems Worm (C. elegans) Fly (Drosophila melanogaster) Fish (zebrafish, medaka) Mouse Xenopus (laevis, tropicalis) Chick (Quail) Sea urchin (echinoderm) Many systems available: which one to use: most powerful one where you can study your questions of interest. (also, many of these model systems are used to study processes other than developmental biology). 4

  5. Drosophila melanogaster Arbacia punculata Gallus domesticus MODEL SYSTEMS for the experimental analysis of development Mus musculis Xenopus laevis and tropicalis Caenorhabditis elegans 5

  6. One of the answers to some of these questions: Differential Gene Expression - DNA is the same in all cells: genomic equivalence - Some genes are mutated, or silenced but not lost!!!!!!! 6

  7. Central Dogma of Life Reverse Transcription 7

  8. How to prove that some genes are expressed and some are not? • Test for TEMPORAL/SPATIAL expression of RNA • Blotting • In situ hybridization • PCR • Test for the function of a certain gene • Gain of function: microinjection • Transfection • Electroporation • Transgenic animals • Loss of function 8

  9. Staining to find -how the cells look (anatomy) TISSUE CELLS Histology Cell Biology TOOLS Proteins Molecular Biology Biochemistry Western Blotting -To detect proteins ELISA -To quantify proteins Enzyme Assays -To measure enzyme activity DNA Southern Blotting -To find copy number of genes Genome Sequencing Northern Blotting Real-Time PCR -To study gene expression RNA 9

  10. Blotting Techniques • Northern Blotting ( mRNA expression) • Southern Blotting (copy number) • Western Blotting ( protein expression) 10

  11. Western Blotting 11

  12. Western Blotting 12

  13. E Enzyme Protein molecule that performs a chemical reaction L Linked Linking an enzyme to an assay/test Attachment of antibodies I Immuno S Sorbent Test to find out something A Assay • Technique based on antigen-antibody reaction 13

  14. Well with antibodies and BSA added Well with antibodies Well with antibodies, BSA, and test sample Well in a microtiter plate Antibody structure Well after washes with wash buffer ELISA Well after adding substrate Color developed due to the formation of a substrate Secondary antibody linked to an enzynme is added to the well Well after removing excess antibody 14

  15. Southern / Northern Blotting 15

  16. In situ hybridization 16

  17. PCR RT-PCR Real-Time PCR -To study gene expression 17

  18. PCR : Polymerase Chain Reaction 18

  19. Reverse Transcriptase- Polymerase Chain Reaction End of 35 cycles 236 = millions of copies PCR products RT Marker RNA 22 23 24 32 copies 8 copies 4 copies 16 copies 19

  20. Preparation of cDNA or first strand RT Reverse Transcription 5’ GACCCAAUUGGUCAGCUAAAAAAA 3’ mRNA 5’ GACCCAAUUGGUCAGCUAAAAAAA 3’ Reverse transcriptase ……TTTTTTT 5’ A, T, G, C dNTPs Reverse Transcription 3’ CTGGGTTAACCAGTCGATTTTTTT 5’ 1ST strand cDNA (complementary DNA) 20

  21. Fate mapping 21

  22. Gain-of-Function Transgenic animal Loss-of-Function RNAi 22

  23. Gain-of-Function/Trangenics 23

  24. Loss-of-Function/RNAi 24

  25. Loss-of-Function/RNAi 25

  26. THE END

More Related