1 / 24

DNA-Based Microbial Analysis Microbe Detectives Trevor Ghylin, P. E .

What’s living in your water?™. DNA-Based Microbial Analysis Microbe Detectives Trevor Ghylin, P. E . Global Water Center, Milwaukee, WI. trevor.ghylin @microbedetectives.com 414-217- 7784 www.microbedetectives.com. Company Introduction. My Background Professional Engineer – CH2M Hill

flower
Download Presentation

DNA-Based Microbial Analysis Microbe Detectives Trevor Ghylin, P. E .

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. What’s living in your water?™ DNA-Based Microbial Analysis Microbe DetectivesTrevor Ghylin, P. E. Global Water Center, Milwaukee, WI trevor.ghylin@microbedetectives.com 414-217-7784www.microbedetectives.com

  2. Company Introduction • My Background • Professional Engineer – CH2M Hill • WEF CanhamGraduate Studies Fellowship • NIH Biotechnology Training Program Fellow • PhD Candidate – Biotechnology • Founded in 2012 to improve access to DNA sequencing services • Global Freshwater Seed Accelerator Winner • Rising Star Award - Early Stage Symposium • Advisory Board - Current and former IWA presidents • Key Developers - Biomolecular Engineer, Bioinformaticist • Clients – CH2M Hill, Milwaukee Water, Consulting Firms

  3. Current paradigm Problem: >99% of microbes can’t be cultured or identified under a microscope

  4. Solution

  5. DNA-Based Microbial Analysis Sterilize, Preserve, Ship Add ethanol to 70% concentration to sterilize. Dilute with water to 25% for preservation and shipping (Shipping via Fedex: 5 days/$85USD/51GBP CollectEnvironmental Sample (50mL sterile bottle) Concentrate Centrifuge or Filtration Extract DNA/Purify DNA Sequencing PCR Amplification/DNA Sequencing ATGCATT…... Assign Taxonomy (Proprietary) Bioinformatics/DNA Processing/Taxonomic Assignment Nitrosomonas Healthy AOB population Interpretation of Results (Proprietary)

  6. Example DNA Data >594682 TACGGAGGATCCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTACGTAGGCGGACCCG TCAGTCAGTGGTGAAAGTTTGCAGCTTAACTGTAAAATTGCCATTGAAACTACGGGTCTT GAGTGTAAATGAGGTAGGCGGAATGTGTTGTGTAGCGGTGAAATGCTTAGATATAACACA GAACACCAATTGCGAAGGCAGCTTACTGGGATACAACTGACGCTGAGGCACGAAAGCGTG GGGATCAAACAGG >594511 TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAACGCAGGCTGGAGAT TAAGCGTGCTGTGAAATGTACCGGCTCAACCGGTGACGTGCAGCGCGAACTGGTTTCCTT GAGTGAGTACGACGTCAGCGGAATTCGTGGTGTAGCGGTGAAATGCTTAGATATCACGAA

  7. Database of Wastewater Microbes (Proprietary)

  8. Solution Cont’d • Novelty • Economically feasible • Proprietary DNA databases and microbial knowledge • Applications • Membrane Biofouling Troubleshooting • Wastewater Treatment Troubleshooting • Fecal Source Tracking • Drinking water distribution system monitoring and troubleshooting

  9. Solution Cont’d • Benefits • Wastewater Treatment • Solve treatment problems • Reduce energy and chemical consumption • Maximisedigester energy production • Maximiseeffluent quality • Membrane Treatment • Solve Biofouling issues • Reduce chemical consumption • Reduce operational and maintenance labor • Increase membrane life • Drinking Water • Solve taste/odor issues • Solve coliform issues • Ensure quality and safety • Identify and fix distribution system issues

  10. Case Studies

  11. Membrane Biofouling

  12. Membrane BiofoulingCont’d

  13. Wastewater Treatment • Municipal SBR – Filamentous Bulking in Spring • SVI~300 • Poor settling, poor effluent quality • Potential to exceed permit TSS limit

  14. Microscopy Results

  15. Drinking Water Distribution System Case Study

  16. Costs • Project specific • Membrane Biofouling • $2,000USD (1,200 GBP) analysis (save >$10,000 USD/6,000GBP in chemical/operational) • Wastewater Treatment • $600USD (350 GBP) for 1 sample ($1000USD/600GBP) with microscopy) • Drinking Water • Provide distribution system insurance for pennies per resident • Business Model • Mail-in service business with additional consulting fee ($140/hr USD/85 GBP) • Return on investment can be extremely high

  17. Status and Path Forward • Currently serving clients in drinking water and wastewater • Pilot studies • Wastewater Treatment • Year-long pilot; weekly or monthly samples • Drinking Water Distribution System • Single sampling event; collect samples from various locations in the distribution system • Multiple cities to generate more data • Membrane Biofouling

  18. Status and Path Forward Cont’d • Plans • Pilot studies • Continue to serve clients and build our knowledge, refine our databases • Milwaukee distribution system project • Support Needed • Wastewater Treatment Demonstration • Membrane Biofouling Demonstration • Drinking Water Distribution System Demonstration

  19. Summary and next steps • DNA analysis is economical • Superior to existing petri dish and microscopy methods • Need partners to do more extensive pilot testing work and demonstrate results • Reduced energy and chemical consumption • Improved drinking water quality • Improved membrane performance

  20. Thank You What’s living in your water? Global Water Center, Milwaukee, WI trevor.ghylin@microbedetectives.com 414-217-7784www.microbedetectives.com LinkedIn: Trevor Ghylin

More Related