1 / 15

Thursday, 5/9/2013

Thursday, 5/9/2013. Objective: SWBAT review chapter 12 material. Warm-up Questions: Are you going to study tonight for tomorrow’s test? Did you finish your journal check?. Chapter 12 Review. Battle Royale-Style. Battle Royale Rules!.

freya-petersen
Download Presentation

Thursday, 5/9/2013

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Thursday, 5/9/2013 Objective: SWBAT review chapter 12 material. Warm-up Questions: • Are you going to study tonight for tomorrow’s test? • Did you finish your journal check?

  2. Chapter 12 Review Battle Royale-Style

  3. Battle Royale Rules! • Each person from your team will be up at the board one time. • Each person from your team may go up to the board to assist someone one time. After that they may not be a helper for the remainder of the game. No direct communication between the group and the board. • You must show your work with appropriate units for math problems. • You must write in a complete, stand-alone sentence for explanations (IQIA). • Lists must be written in order (answers only) • The point will be awarded for the team with the correct, complete answer that puts their pen down first. • EC for the winning team!!!

  4. Let’s assemble teams!

  5. You must answer in a complete sentence! • Write three complete sentences contrasting DNA and RNA. Each sentence must have information about each nucleic acid. Example: Mr. Allen has lots and lots of friends, but Mr. Stephens has few/no friends. Sugar (ribose/deoxyribose); bases (thymine/uracil); single vs. double stranded; one type vs. three types

  6. Reorder and rewrite! • Rearrange and rewrite the major events of transcription and translation in the order that they occur. • The complete polypeptide is released. • Messenger RNA is transcribed from DNA • Amino acids are joined until a stop codon is reached. • mRNA leaves the nucleus • tRNA brings methionine to the start codon • mRNA goes to ribosome

  7. Reorder and rewrite! • Rearrange the major events of transcription and translation in the order that they occur. • Messenger RNA is transcribed from DNA • mRNA leaves the nucleus • mRNA goes to ribosome • tRNA brings methionine to the start codon • Amino acids are joined until a stop codon is reached. • The complete polypeptide is released.

  8. You must answer in a complete sentence! 3. Write three complete sentences contrasting DNA replication and transcription. Each sentence must have information about each process. Example: Mr. Allen dresses professionally, but Mr. Stephens dresses like a hobo. Enzymes used; types of nucleotides added; final product

  9. You must answer in a complete sentence! 4. What are the three types of RNA and their functions? mRNA = carries message from DNA to ribosome rRNA = part of ribosome, helps make proteins tRNA = carries amino acids to ribosome, converts mRNA into protein

  10. SHOW YOUR WORK! 5. Transcribe and translate the following DNA template: TACGGACCCCTTTAAATGCTGGTTGACACT AUGCCUGGGGAAAUUUACGACCAACUGUGA MET PRO GLY GLU ISO TYR ASP GLN LEU STOP

  11. No sentences 6. Use the following DNA sequence to show examples of the three gene mutations. Write the mutated sequence, circle the mutation and label the mutation type. You should end up with three separate DNA sequences. TACGGACCC Point (substitution), Frameshift (deletion, insertion)

  12. You must answer in a complete sentence! 7. Write one or two sentences that relate the following vocabulary terms: TATA box, promoter, RNA polymerase, gene, transcription. Please underline each vocabulary word used. A TATA box helps RNA polymerase bind to the promoter of a gene during transcription.

  13. You must make a pretty picture! 8. Draw a picture of DNA molecule that is three nucleotides long. Label the parts of one nucleotide, show appropriate base-paring rules and label the hydrogen bond(s).

  14. You must answer in a complete sentence! • Write a few sentences that relate the following vocabulary terms—codon; anticodon; tRNA; mRNA; nucleotide; amino acid; polypeptide.Please underline each vocabulary word used. • Three nucleotides on mRNA is a codon, which are complementary to anticodons on tRNA. Each tRNA molecule carries a specific amino acid, which are joined by bonds to form a polypeptide chain.

  15. Complete sentence! • What is the basic function of HOX genes? • Body plan in multicellular organisms.

More Related