Mingfang Wu, Stefanie Kethers , Andrew Treloar

1. Mingfang Wu, Stefanie Kethers, Andrew Treloar Getting from managed to reused: Making it easier for researchers to do something useful with data

2. What is ANDS? • ANDS is supported by the Australian Government • Began in 2009, currently funded to mid 2015 • Collaboration between Monash University, CSIRO and the Australian National University • Staff in 6 cities across the country • Funded 200+ projects across 68 institutions ANDS aims to make data more valuable to researchers, research institutions and the nation

3. How Do We Make Data More Valuable? Value So that researchers can easily publish, discover, access and use research data through the Australian Research Data Commons.

4. ANDS Programs • Underpinning infrastructure for discovery and citation (ARDC Core) • Enable rich metadata about data to be managed and accessible (Metadata Stores) • Make new data and associated metadata available from range of instruments (Data Capture) • Make a selection of existing data and associated metadata available from Australia’s research-producing universities (Seeding the Commons) • Make data and associated metadata available from government departments (Public Sector Data) • Provide the overall policy and practice frameworks to support better data management and re-use (Frameworks and Capabilities) • Demonstrate the value of doing all these (Applications)

5. Tools for Data-reuse Research Activities Form Hypothesis Look UpData Publish Paper,Data, Software AnalyseData/Results Design & Run Experiment Computing Transform Data Analyse Data Discover Data Workflow Extract Data Visualise Data Register Data Integrate Data Data Data Collections Metadata

6. The ANDS Applications Program • Funded through EIF (Education Infrastructure Fund) • Focus on Software Infrastructure to enable research • Goal of the Applications program: “to produce compelling demonstrations of the value of having data available for re-use” (i.e. enabling research across many sources of data that was not previously possible).

7. Developed software might… • empower researchers to solve important problems • build new connections • enable important problems to be solved • enable new questions to be answered • simplify problems • accelerate solving problems, or analysing data

8. What have been funded under the apps program? • 7 projects in bio/characterisation • 8 projects in climate change adaptation • 10 others (urban planning, marine research, public health, humanity) • For a completed list of the apps projects and their profiles, please visit ANDS project registry: https://projects.ands.org.au/getAllProjects.php?start=app

9. What kind of tools have been developed? • Data transformation • Data linkage and integration • Data service • Data analysis and modelling • Data visulisation • Data manipulation workflow ….

10. Example Applications • Climate Model Downscaling Data for Impacts Research • Cancer Genomics Linkage Application • Brain Mapping National Resource • POSITIVE PLACES: Spatial Analysis of Public Open Space

11. Climate Model Downscaling Data for Impacts Research Very big! High spatial and temporal resolution Large region Many climate variables Many atmospheric layers Multiple simulations Data on an irregular model grid Stored in netCDF Regional Climate Model Data Collection

12. Regional Climate Model Downscaling Data Agricultural Impacts Researchers Hydrological Impact Researchers Health Impacts Researchers Ecological Impacts Group

13. Regional Climate Model Downscaling Data Impacts-relevant high res Very big! High spatial and temporal resolution Large region Many climate variables Many atmospheric layers Multiple simulations Data on an irregular model grid Stored in netCDF Climate Change Impact Researchers: I see some problems! What is a Regional Climate Model? I don’t have enough disk space for this dataset on my computer I can’t find data for the sites I’m interested in My software tools can’t handle this irregular grid. I can’t read this netCDF data format This data set doesn’t contain data for my site This data gives me strange results for the current climate This dataset is great! – How can I share my work on it with others?

14. Data service – Climate Model Downscaling Data for Impact Research (CliMDDIR) (AP04, UNSW) • Provide open source software to transform RCM data • Extract subsets of data (e.g. variables, regions) • Regrid or interpolate data to sites • Reformat data (e.g. GIS, ASCII, CSV) • Calculate derived variables (e.g. pan evaporation) • Apply statistical corrections (if necessary) http://www.climddir.org/node/33

15. CliMDDIR Service Collection Description at RDA Service Description at RDA

16. CliMDDIR Service Portal • Climate impact researchers can • select region • select time coverage • select variables • select simulation models • select output format • share (sub-set) data to other researchers

17. Agricultural Impact Researchers Climate Modellers Assess how climate change impact onwheat cropping in NSW using the APSIM agriculture model IT Specialists

18. Workflow - Cancer Genome Linkage Project • Challenges faced by biologists and Clinicians: • The manual process required to integrated their research data with other data sets • No availability of standarised analytical processes • The delay in transitioning from analysis to publication ready result Raw data tttctgaagaccatggactatgagacctct Derived Data (i.e. mutation info) is released throughthe ICGC Data Portal http://ap27-cgla.blogspot.com.au/

19. Workflow - Cancer Genome Linkage Project Variant detection pipeline in Galaxy Provide software/infrastructure to enable integration/transformation of multiple datasets within the GVL environment Software Development by QFAB (Queensland Facility for Advanced Bioinformatics, UQ) Development aligned with that of the NeCTAR GVL Inclusion of the very large raw ICGC Pancreatic Dataset into the NeCTARGVL Development of (reusable) Galaxy Workflows for easier mutation searching

20. Workflow - Cancer Genome Linkage Project Screenshots of output data

21. Workflow - Cancer Genome Linkage Project

22. Data Visualisation Brain Mapping National Resource • Funded at QCIF and Centre for Advanced Imaging, UQ • Developed TissueStack that can link to specific parts of the data, , and rapidly view and collaboratively annotate on very large 3D datasets via a web browser. • For detail, please go to Dr. Andrew Janke’s presentation on Wed. 12:05 – 12:25, Room:P1

23. POSITIVE PLACES: spatial analysis of public open space • Are the current provisions of POS and parks adequate for the projected urban densification and population growth? • Will there be enough POS? (i.e. will it meet the 10% land provision still?) • Will the provision of different park types and facilities that encourage use by different population demographics (i.e. small pocket parks with play equipment for young children) or for different uses (i.e. active or passive recreation) be adequate? What more / less will be needed? • Is there sufficient large open space for active recreation and sporting needs? • What type of POS can promote increase social connectedness within communities? Challenge: lack of a comprehensive and consistent digital datasets of public open space

24. Data integration and interrogation: Public Open Space (POS) Tool developed at UWA • 7624 areas of POS • 3813 parks (up to 43 different facilities and amenities per park) • 820 school grounds/playing fields • 1860 natural and conservation or bushland areas • 771 areas of residual green space POS statistics of a searched suburb or LGA can be downloaded as an Excel spreadsheet • With advance features, users can: • define area of interest directly on screen • upload a user defined region as a GIS shapefile • scenario test the relationship between changes in population structure for a user defined area and the provision of POS http://positiveplaces.blogspot.com.au/

25. Who benefit from the applications projects? Prof. Charles Watson, from Curtin University and neuroscience Research Australia commented that “The ability to share data from cloud, access it through TissueStack, would make a huge difference to the way we are able to interact, the ability for all participates to access the same dataset, to annotate it and to have a discussion on the way forward. Max De AntoniMigliorati(PhD Candidate from QUT) on Semaphore: monitoring and Modelling Australian Gas Emissions: It is much more time effective, it is much more easier to get our result with Semaphore. Now I can run 5 simulation today, while a previous method, it took me one day to get one simulation done. • Researchers • Conduct existing research more efficiently • Enable new research • Increase research collaboration opportunities • Strength relationship with government agencies and industries • Connect science to the public • Government agencies, urban planner, and infrastructure planner, … • The public

26. Summary • Substantial data infrastructures have been built to enable data sharing and data reuse • The ANDS application program has demonstrated the value of data sharing and data reuse

27. Information • ANDS project registry: https://projects.ands.org.au/getAllProjects.php?start=all • Project blogs: http://andsapps.blogspot.com.au/p/project-feed.html • Demonstrations of value: http://andsapps.blogspot.com.au/p/resources.html

28. Thanks • To Ian Macadam (from UNSW) for providing some slides about CliMDDIR project • To all who have participated in and contributed to the program

29. Questions?