DNA Forensics

1. DNA Forensics How DNA is used Ethical Issues By : Daniel DiCenzo

2. What is DNA? • DNA - Deoxyribonucleic acid • DNA is the blueprint for the design of our bodies • Consists of certain base pairs that form specific sequences • These sequences can code for specific amino acids • These amino acids combine to form proteins • The proteins together make our entire body • Everyone’s DNA is unique • DNA holds all of the information needed to make living things

3. What is DNA used to do? • Code for amino acids in our bodies • Act as a bar code that identifies who we are (DNA Fingerprint) • DNA can be analyzed and compared to other DNA • Comparing DNA can be used for many purposes • To match and analyze people’s DNA, scientists must perform special tests

4. What Are These Tests • There are many ways to process DNA • Polymerase Chain Reaction (PCR) • Restriction Fragment Length Polymorphism (RFLP) • Short Tandem Repeat (STR) • Mitochondrial DNA (mtDNA) • DNA is taken from mitochondrion instead of nucleus

5. Polymerase Chain Reaction • To put it simply PCR’s are used to amplify a certain piece of DNA • The initial piece of DNA is separated into two strands • RNA primer is attached at specific spot on DNA • DNA polymerase adds base pairs to both single stranded DNA • The product is two identical pieces of double stranded DNA • This process is repeated many times to achieve a large amount of DNA • The amount of DNA produced after every cycle however increases exponentially • This process allows a large amount of DNA to be produced from only a minute sample collected http://campus.queens.edu/faculty/jannr/Genetics/images/dnatech/FG12_11cPCR2.JPG

6. Restriction Fragment Length Polymorphism • DNA is cut at specific points into fragments • These fragments are then put in a gel • Via “gel electrophoresis” the DNA fragments travel across the gel and stop at specific distances • DNA can be compared to other DNA run through this same method • This process however requires a large amount of DNA sample http://www.ars.usda.gov/pandp/docs.htm?docid=11828

7. Short Tandem Repeat • Example of a tandem repeat • TAAGCTAAGCTAAGCTAAGC • In this tandem repeat – TAAGC is repeated four times • Every person’s DNA contains these tandem reapeats • These are inherited from your mother and your father • These are used in identification because they are very unique in individuals • Scientists analyze 13 loci in our DNA, this prevents any doubt that someone else shares these same genes • If only 2 loci are analyzed the probability that someone else shares those genes are much higher which is not effective in identifying people using DNA

8. What are these fingerprints used for? • DNA fingerprinting has many uses • DNA fingerprinting has the ability to: • Prove someone is guilty/innocent of a crime • Instantly find the culprit if they are in a DNA database • Identify unknown bodies (old or new) • Determine who the father of a baby is (Paternity Test) • Find an organ match for a person • Catch poachers hunting and selling the meat of endangered animals

9. Ethical Issues • DNA identification Act (1998) • Forces all those in Canada who have been convicted of a certain crime to be entered into the National DNA Databank (NDDB) • This is also the case in the U.S. • In 1998, all 50 states used their DNA databank, known as the National DNA Index System (NDIS) • Having to be forced to provide DNA is a violation of human rights, even if you are a criminal • Many believe in the future, everyone’s DNA will be on file • All of our most valuable secrets are exposed • Many believe this is an invasion of privacy • Our DNA can predict how we will die, do we want that information?

10. Genetic Discrimination • DNA holds secret to almost every weakness you have • By allowing Insurance companies, employers, schools or banks access to any illness or flaw that you will, may or already have, you can be denied instantly • Government can learn anything about you without your consent • Those with “Good” DNA will be given better opportunities and success than those with “Bad” DNA • This will lead to a new discrimination, not by race or religion, but by your DNA

11. Is DNA fingerprinting Reliable? • People have come to believe that DNA evidence is indisputable in courtrooms (Too much faith in DNA) • Human error is always a factor • Contamination of evidence • Labs are too pressured by police to give them the evidence they want to close the case • With more strict regulations on the quality of labs and technological advances, human error will be greatly reduced • Planting of evidence is a new problem • This always leaves doubt into the reliability of DNA evidence • Must look for probable cause in a case and not rely solely on DNA evidence

12. DNA Databanks • There are approximately 200 000 people in the Canadian National DNA Databank • To this date there have been 10 000 offender hits because of this system • In the U.S., 6.5 million people have been entered into their national DNA databank • This databank is the largest in the world and has participated in over 77 000 investigations

13. Taken from NDDB statistics page http://www.nddb-bndg.org/stats_e.htm

14. Taken from NDDB annual report for 2006/2007 http://www.nddb-bndg.org/an_report_e.htm

15. Conclusion • DNA holds all of the secrets of our bodies • There are many ways that DNA can be used to identify and learn about other people • It is an effective tool in crime solving • The use of DNA databanks has caused major concern over the civil rights of convicted felons and possibly in the future, the civil rights of everyone • If people’s DNA is exposed, there is concern for our privacy being violated

16. Bibliography • Federal Bureau of Investigation. (2008). CODIS – NDIS Statistics. Retrieved December 9, 2008, from: http://www.fbi.gov/hq/lab/codis/clickmap.htm • Fink, Sheri. (2006, July). Reasonable Doubt. Discover, 27(7), 54-59. Retrieved from EBSCO host database. • Fridell, Ron. (2001). DNA Fingerprinting The Ultimate Identity. Toronto: Franklin Watts. • Genge, N.E. (2002). The Forensic Casebook. New York: Ballantine Publishing Group. • Human Genome Project Information. (2008). DNA Forensics. Retrieved November 10, 2008, from: http://www.ornl.gov/sci/techresources/Human_Genome/elsi/forensics.shtml#1 • Lampton, Christopher. (1991). DNA Fingerprinting. Boston: Christopher Lampton. • Learn Genetics. (2008). Can DNA demand a verdict?. Retrieved December 1, 2008, from: http://learn.genetics.utah.edu/content/labs/gel/forensics/ • National DNA Databank. (2006). Welcome to the National DNA Databank Website. Retrieved November 20, 2008, from: http://www.nddb-bndg.org/main_e.htm • Zonderman, Jon. (1990). Beyond the Crime Lab. Toronto: John Wiley and Sons.