Introductory Questions #2

1. Introductory Questions #2 • Name the organism used by Meselson & Stahl to label the DNA. • Name all of the enzymes required for DNA replication to occur and what purpose they serve. • In what direction is the newly synthesized strand made? What end of the newly synthesized strand are nucleotides add to? • What direction is the new strand growing? (towards or away from the replication fork) • How long (# nucleotides) are the Okasaki fragments? How long are the RNA primers? • How is the RNA primer removed and replaced with DNA nucleotides?

2. Issues with Replication • Prokaryotes: (ex. E. coli) • Have one singular loop of DNA • E. coli has approx. 4.6 million Nucleotide base pairs • Rate for replication: 500 nucleotides per second • Eukaryotes w/Chromosomes: • Each chromosome is one DNA molecule • Humans (46) has approx. billion base pairs • Rate for replication: 50 per second (humans) • Errors: • Rate is one every 10 billion nucleotides copied • Proofreading is achieved by DNA polymerase (pg. 305)

3. Telomeres

4. Telomeres • Short, non-coding pieces of DNA • Contains repeated sequences (ie. TTGGGG 20 times) • Can lengthen with an enzyme called Telomerase • Lengthening telomeres will allow more replications to occur. • Telomerase is found in cells that have an unlimited number of cell cycles (commonly observed in cancer cells) • Artificially giving cells telemerase can induce cells to become cancerous • Shortening of these telomeres may contribute to cell aging and Apotosis (programmed cell death) Ex. A 70 yr old person’s cells divide approx. 20-30X vs an infant which will divide 80-90X

5. Key Discoveries • Miescher (isolated “nuclein” from soiled bandages) 1869 • Garrod (Proteins & inborn errors) 1902 • Sutton (Chromosome structure) 1903 • Morgan (Gene mapping)1913 • Sumner (Purified Urease, showed it to be an enzyme) 1926 • Griffith’s Experiment (Transforming Principle) 1928 • Avery, McCarty, and Macleod 1944 • Chargaff (Base pairing & species specific) 1947 • Hershey and Chase 1952 • Pauling, Wilkins, and Franklin 1950’s • Watson and Crick 1953 • Meselson & Stahl 1956

6. Introductory Questions #3 • Name the substance that accumulates in a person’s urine causing alkaptonuria. • Why did Beadle and Tatum use breadmold spores to determine that one gene forms one polypeptide allowing for the first metabolic pathway to be defined? • Transcribe & Translate the following sequence of DNA by determining the nucleotide sequence for mRNA, the anticodon for tRNA, and the overall amino acid sequence: TACTCAGGACCTGCAACGATT mRNA: ??????????????????????????????? Amino acids Sequence: ??????????????????????????????? Anticodon: ??????????????????????????????? • How does the DNA and amino acid sequences differ from a person with sickle cell anemia and a person with normal hemoglobin in their RBC’s? (pg. 328) • When mRNA is “processed” what is taken out (spliced)?

7. Protein Synthesis: Chapter 17 Bridging the gap between Genotype & Phenotypes (proteins are thought to be that link) Trace the Flow of Information from Gene to Protein Key Topics: • Garrod • Beadle & Tatum • Transcription (nucleus) • Processing mRNA • Translation (cytoplasm) • Completed polypeptide (protein)

8. Archibald Garrod (1902-1908) • First to suggest that genes dictate phenotypes through enzymes and their metabolic, catalytic properties. • Studied a rare genetic disorder: Alkaptonuria • Thought to be a recessive disorder • Tyrosine is not broken down properly into carbon dioxide and water. • An Intermediate substance: “Homogentisic acid” accumulates in the urine turning it BLACK when exposed to air. • An enzyme was thought to be lacking • A genetic mutation was thought to be the cause “An Inborn Error of Metabolism”

9. Metabolic Pathway for the breakdown of Tyrosine Tyrosine ↓ Hydroxyphenylpyruvate ↓ Homogentisic acid Alkaptonuria Maleyacetoacetate Inactive (lacking) enzyme (active ↓ enzyme) CO2 & H2O

10. Garrod’s Conclusion • A mutation in a specific gene is associated with the absence of a specific enzyme. • Led to the idea of: “One gene, One Enzyme” • Not validated until Beadle & Tatum’s work in the 1940’s with Neurospora (breadmold)

11. James Sumner (1926) • Isolated the enzyme “Urease” • First to identify an enzyme as a protein • First to crystallize an enzyme • Awarded the Nobel prize in 1946 in chemistry for his crystallization of an enzyme.

12. Studies of the bread mold Neurospora crassa led to the one gene-one polypeptide hypothesis (Beadle & Tatum) • Studies of inherited metabolic disorders first suggested that phenotype is expressed through proteins Figure 10.6B

13. George Beadle & EdwardTatum • Discovered the “One Gene, One Enzyme” Principle • Analyzed mutations that interfered with a known metabolic pathway • Organism they chose to work with: Neurospora (breadmold) -Grows easily -Grows as a haploid: (no homologs) -Mutants are easily identified: Dominant allele won’t be expressed • Neurospora can grow easily in only: salt, sugar, & Biotin (vitamin)

14. George Beadle & EdwardTatum cont’d • Mutants-are unable to make certain organic molecules: amino acids, lipids, etc. • These substances are added to the media which will allow mutants to grow successfully • Exposed the haploid spores to x rays & UV to induce mutations • Haploid spores were crossed, grown in a variety of media to determine what kind of mutation was occurring • **They examined the effect of the mutation instead of identifying the enzyme.

15. Beadle & Tatum Experiment w/Neurospora

16. Beadle & Tatum’s Conclusion “One Gene affects One Enzyme” Later  Revised “One Gene affects One Protein” Later  Revised “One Gene affects One Polypeptide Chain”

17. THE FLOW OF GENETIC INFORMATION DNA → RNA → PROTEIN • The information constituting an organism’s genotype is carried in its sequence of bases

18. Protein Synthesis: overview • One gene-one enzyme hypothesis (Beadle and Tatum) • One gene-one polypeptide (protein) hypothesis • Transcription: synthesis of RNA under the direction of DNA (mRNA) • Translation: actual synthesis of a polypeptide under the direction of mRNA

19. Genetic Information Written in Codons is Translated into Amino acid Sequences • The “words” of the DNA “language” are triplets of bases called codons • The codons in a gene specify the amino acid sequence of a polypeptide

20. Various Types of RNA Molecules

21. Gene 1 Gene 3 DNA molecule Gene 2 DNA strand TRANSCRIPTION RNA Codon TRANSLATION Polypeptide Amino acid Figure 10.7

22. Transcribed strand 4) How many sites are present in the ribosome? Name the enzyme that is used to attach an amino acid to the tRNA molecule. • An exercise in translating the genetic code DNA Transcription RNA Startcodon Stopcodon Translation Polypeptide Figure 10.8B

23. The Genetic Code Dictionary • Virtually all organisms share the same genetic code • 1st codon determined was “UUU” by Marshal Nirenberg in 1961. • All of the codons were determined by the mid 1960’s Figure 10.8A

24. RNA polymerase DNA of gene Promoter DNA Terminator DNA Initiation • RNA nucleotides line up along one strand of the DNA following the base-pairing rules • The single-stranded messenger RNA peels away and the DNA strands rejoin • In transcription, the DNA helix unzips Elongation Area shownin Figure 10.9A Termination GrowingRNA Completed RNA RNApolymerase Figure 10.9B

25. Transcription • Occurs in the nucleus • RNA Polymerase is needed -Adds nucleotides to the 3’ end only -Eukaryotes have three types vs. Bacteria with only one type • Elongation occurs from 5’  3’ direction • TATA Box : initiation site for the attachment of RNA polymerase • 3 Steps: Initiation  Elongation  Termination

26. Transcription: Initiation • RNA Polymerase binds to the “Promoter” region on the DNA (upstream about 25 nucleotides) • RNA Polymerase recognizes this region because of the “TATA” box • Other proteins also are needed: “Transcription factors”

27. Transcription produces genetic messages in the form of RNA RNA nucleotide RNApolymerase Direction oftranscription Templatestrand of DNA Newly made RNA Figure 10.9A

28. Transcription: Elongation • DNA is untwisted (hydrogen bonds are broken) • About 10 base pairs are exposed • Nucleotides are are added to the 3’ end of the growing mRNA molecule • Proceeds at a rate of: 60 nucleotides/sec

29. Transcription: Termination • Termination site is reached by RNA Polyermase • In Eukaryotes “AATAAA” is the signal • In Bacteria Translation can occur as it is released from the first transcription event • Final mRNA molecule is made consisting of “Coded” and “Non-coded” regions

30. Transcription- The three Phases

31. Eukaryotic RNA is processed before leaving the nucleus Exon Intron Exon Intron Exon DNA TranscriptionAddition of cap and tail • Noncoding segments called introns are spliced out • A cap and a tail are added to the ends • http://highered.mcgraw-hill.com/sites/0072437316/student_view0/chapter15/animations.html# Cap RNAtranscriptwith capand tail Introns removed Tail Exons spliced together mRNA Coding sequence NUCLEUS CYTOPLASM Figure 10.10

32. mRNA Structure • 1) 5’ cap: modified guanine; protection; recognition site for ribosomes • 2) 3’ tail: poly(A) tail (adenine); protection; recognition; transport • 3) RNA splicing: involves introns & Exons • Exons (expressed sequences) retained • Introns (intervening sequences) -These are spliced out / spliceosome

33. Key Regions on Newly Transcribed mRNA

34. Splicesomes w/ SNRP’s(Small nuclear Ribonuclearprotein)

35. Animated View of Transcription • http://highered.mcgraw-hill.com/sites/0072437316/student_view0/chapter15/animations.html#

36. Translation • Occurs in the Cytoplasm • Key molecules and structures include: • mRNA • tRNA • Ribosome (30s and 40s subunits) • Free floating amino acids • Endoplasmic reticulum

37. Translation: Overview

38. Transfer RNA molecules serve as interpreters during translation Amino acid attachment site • In the cytoplasm, a ribosome attaches to the mRNA and translates its message into a polypeptide • The process is aided by transfer RNAs Hydrogen bond RNA polynucleotide chain Anticodon Figure 10.11A

39. A Typical tRNA Molecule

40. Translation: Transfer RNA (tRNA)-Pg. 273 mRNA from nucleus is ‘read’ along its codons by tRNA’s anticodons at the ribosome tRNA – has the anticodon and amino acid attached

41. Each tRNA molecule has a triplet anticodon on one end and an amino acid attachment site on the other Amino acidattachment site Anticodon Figure 10.11B, C

42. Attachment of an Amino Acid (Pg 273)

43. Translation- the Ribosome rRNAsite of mRNA codon & tRNA anticodon coupling P site holds the tRNA carrying the growing polypeptide chain A site holds the tRNA carrying the next amino acid to be added to the chain E site discharged tRNA’s

44. Animated View of Transcription • http://highered.mcgraw-hill.com/sites/0072437316/student_view0/chapter15/animations.html#

45. Translation • Initiation~union of mRNA, tRNA, small ribosomal subunit; followed by large subunit • Elongation~•codon recognition •peptide bond formaton •translocation • Termination~‘stop’ codon reaches ‘A’ site • Polyribosomes:translation of mRNA by many ribosomes (many copies of a polypeptide very quickly)

46. Video #2:Proteins-Building Blocks of Life • Name the structures identified by Dr. James Lake that has helped him to trace the hereditary path of life back to the first cell. • What type of therapy is suggested by Dr. Richard Firtel that may provide long term help for patients suffering from sickle cell anemia? • In the third segment what type of organism is profiled? How do prokaryotic cells switch protein production on and off? • Write the title for all three segments and list five key statements for each segment.

47. Transcription & translation in Prokaryotes

48. Introductory Questions #3 • Transcribe & Translate the following sequence of DNA: TACTCAGGACCTGCAACGATT mRNA: ??????????????????????????????? Amino acids Sequence: Anticodon: 2) How does the DNA and amino acid sequences differ from a person with sickle cell anemia and a person with normal hemoglobin in their RBC’s? (pg. 328) 3) When mRNA is “processed” what is taken out (spliced)? 4) How many sites are present in the ribosome? Name the enzyme that is used to attach an amino acid to the tRNA molecule.

49. Mutations & Errors During Transcription & Translation

50. DNA Repair • Mismatch repair: DNA polymerase • Excision repair: Nuclease • Telomere ends: telomerase