1 / 30

Molecular Biology Background

Molecular Biology Background. Schematic view of DNA organization in a cell. Genes and Genomes.

glyn
Download Presentation

Molecular Biology Background

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Molecular Biology Background

  2. Schematic view of DNA organization in a cell

  3. Genes and Genomes • A Gene is the fundamental physical and functional unit of heredity. A gene is an ordered sequence of nucleotides located in a particular position on a particular chromosome that encodes a specific functional product (i.e., a protein or RNA molecule). • A Genome is all the genetic material (DNA) in the chromosomes of a particular organism; its size is generally given as its total number of base pairs.

  4. DNA Structure • Four nucleotides: adenine (A), cytosine (C), guanine (G), and thymine (T) • Bindings: • A with T (weaker), C with G (stronger) • Forms a double helix – each strand is linked via sugar-phosphate bonds (strong), strands are linked via hydrogen bonds (weak) • Genome is the part of DNA that encodes proteins: • …AACTCGCATCGAACTCTAAGTC… genetics.gsk.com/ graphics/dna-big.gif

  5. Comparisons between DNA and single stranded RNA with the diagram of the bases showing.

  6. The chemical structure of DNA

  7. Why is genomics interesting for the • signal processing person? • Because there are sequences there! • OK, what sort of sequences? • Sequences from an alphabet of size four: • …ATTCGAAGATTTCAACGGGAAAA… • DNA • 2. Sequences from an alphabet of size twenty: • AACWYDEFGHIKLMNPQRSTVAPPQR • Protein

  8. Size-4 alphabet: A, C, T, G: bases (also called or nucleotides) DNA sequences (genomes) are made of these. Genes are parts of DNA, and are 4-letter sequences. Adenine Thymine Cytosine Guanine or Uracil (in RNA) DNA: deoxyribonucleic acid RNA:ribonucleic acid

  9. Central Dogma of Molecular Biology • Flow of information in a cell • Recent development of high-throughput technologies that study the above flow • requires interdisciplinary effort • dealing with a huge amount of information

  10. Details of the information flow • Replication of DNA • {A,C,G,T} to {A, C, G,T} • Transcription of DNA to mRNA • {A,C,G,T} to {A, C, G,U} • Translation of mRNA to proteins • {A,C,G,U} to {20 amino-acids} http://www-stat.stanford.edu/~susan/courses/s166/central.gif

  11. Genes can be turned on and off

  12. The twenty natural amino acids (B,J,O,U,X,Z missing) 11 essential amino acids. Animals cannot make the eleven indicated amino acids. They need to eat them; Milk provides all of these. Grains and beans together provide all of these.

  13. Protein Example Fibroblast growth factor proteins Basic bovine Acidic bovine length 146 length 140

  14. Example of a Protein: Hemoglobin (oxy, human) http://www.biochem.szote.u-szeged.hu/astrojan/protein2.htm Sequence of amino acids. Folds into beautiful 3D shapes. Necessary for function.

  15. Example of a protein (an enzyme) http://www.biochem.szote.u-szeged.hu/astrojan/protein2.htm

  16. The mapping from amino acids to codons is many-to-one

  17. Computational Gene-Finding

More Related