1 / 28

Distributions of Mutations Associated with Sensorineural Hearing Loss

Distributions of Mutations Associated with Sensorineural Hearing Loss. 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial Disorders Children’s Hospital at Montefiore Bronx, New York February 2, 2006. Faculty Disclosure Information.

gus
Download Presentation

Distributions of Mutations Associated with Sensorineural Hearing Loss

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial Disorders Children’s Hospital at Montefiore Bronx, New York February 2, 2006

  2. Faculty Disclosure Information • In the past 12 months, I have not had a significant financial interest or other relationship with the manufacturer(s) of the product(s) or provider(s) of the service(s) that will be discussed in my presentation. • This presentation will not include discussion of pharmaceuticals or devices that have not been approved by the FDA or of “off-label” uses of pharmaceuticals or devices.

  3. Congenital Hearing Loss • Epidemiology • 1/1000 infants affected • Etiology • 50% genetic • 70% non-syndromic sensorineural hearing loss (SNHL) • 77% autosomal recessive • 52 loci known; 34 identified • 22% autosomal dominant • Remainder are mitochondrial or X-linked

  4. Clinical evaluation of hearing loss • History • Prenatal • Infections, medication exposure • Neonatal • Prematurity, hyperbilirubinemia, infections, medications • Childhood • Ear infections, antibiotics, medical problems • Family history

  5. Clinical evaluation of hearing loss • Physical exam • Dysmorphic features • Ear malformations or effusions • Skin (NF2) • Hair and eyes (Waardenburg) • Testing • EKG (Jervell and Lange-Nielsen syndrome) • +/- urinalysis • CT scan of temporal bones • Genetic testing

  6. GJB2 • Encodes connexin 26 (Cx26) • Gap junction protein in the cochlea • Maps to 13q12 • 2263 nucleotides, 680 amino acids • Two exons; one coding exon • CpG island near Exon 1

  7. GJB2 • AR mutations account for 15 – 40% of inherited SNHL in North America • Carrier rate of 1:33 in Europeans • Most common mutation in Caucasians: 35delG • Mutation spectrum is known to differ by ethnic group

  8. Gap Junction Channels From Rabionet et al in TRENDS in Molecular Medicine Vol.8 No.5 May 2002

  9. Expression of Cx26, Cx30 and Cx31 in the Cochlea From Rabionet et al in TRENDS in Molecular Medicine Vol.8 No.5 May 2002

  10. Preliminary Study • Chart review of 107 patients • Referred to CHAM for genetic evaluation of SNHL • Data collected: • Ethnicity • Cx26 mutation status • mtDNA DNA analysis (nt 1555, 7445, 3243, sequencing of 12s rRNA) • CT scan of temporal bones

  11. Available Samples • 107 Samples obtained from IRB approved research project looking for mtDNA point mutations in SNHL • 192 Controls provided by Dr. Robert Burk from HPV study

  12. mtDNA and CT Results • one Puerto Rican patient: • A503G variant + mtDNA mutation at nt 1465 • no patient had A1555G or T7445C associated with SNHL • 31 patients had CT scan results: • 2 had EVA, one of which carries G79A • 1 had ? Mondini’s, 1 had prominence of cochlear aqueducts, 1 had diffuse atrophy

  13. Project design • Designing primers for PCR • Overcoming the GC content • Primers for Exons 1&2, and CpG island • Sequencing PCR products • Identifying sequence variants with Sequencher • Examine for known SNPs • Screening controls with Pyrosequencing

  14. CpG Island Primers CGCCAGGTTCCTGGCCGGGCAGTCCGGGGCCGGCGGGCTCACCTGCGTCGGGAGGAAGCGCGGCGGGGCCGGGGCGGGGGTCTCGGCGTTGGGGTCTCTGCGCTGGGGCTCCTGCGCTCCTAGGCGGGTCCTGGGCCGGGCGCCGCCGAGGGGCTCCGAGTCGGGGAGAGGAGCGCGCGGGCGCTGCGGGGCCGCAACACCTGTCTCCCGCCGTGGCGCCTTTTAACCGCACCCCACACCCCGCCTCTTCCCTCGGAGACTGGGAAAGTTACGGAGGGGGCGGCGCCGCGGGCGGAGCGCGCCCGGCCTCTGGGTCCTCAGAGCTTCCCGGGTCCGCGAACCCCCGACCGCCCCCGAAAGCCCCGAACCCCCCAAGTCCCCTTCGAGGTCCCGATCTCCTAGTTCCTTTGAGCC

  15. Exon 1 Primers CCCAAGGACGTGTGTTGGTCCAGCCCCCCGGTTCCCCGAGACCCACGCGGCCGGGCAACCGCTCTGGGTCTCGCGGTCCCTCCCCGCGCCAGGTTCCTGGCCGGGCAGTCCGGGGCCGGCGGGCTCACCTGCGTCGGGAGGAAGCGCGGCGGGGCCGGGGCGGGGGTCTCGGCGTTGGGGTCTCTGCGCTGGGGCTCCTGCGCTCCTAGGCGGGTCCTGGGCCGGGCGCCGCCGAGGGGCTCCGAGTCGGGGAGAGGAGCGCGCGGGCGCTGCGGGGCCGCAACACCTGTCTCCCGCCGTGGCGCCTTTTAACCGCACCCCACACCCCGCCTCTTCCCTCGGAGACTGGGAAAGTTACGGA

  16. Exon 2 Coding Region Primers TTATTATAGAGATTATATTTTAATGTTTTAAATGTATTTGATACATTACAAAATTATTTTAGTTACA AGCATATCATTAAAGCTATTCTTTATTATTACAAAATGCTTTTACAATGCTATTCTTGACAACAGG AAAATACTTACCCTCACTGAAATATGTGGAGTACCATTTTTTGGAAACCATGTCAAGCATAATGGC AATATTCAGGTTCAATCTTCCTATAGATCTGCTCAATATTTATCTAAACCTTAGCTTCTATTCTTTT CACATGTTATTAGCTATATTTTCACTTAAAAAATTGGAGGCTGAAGGGGTAAGCAAACAAACTTT TGAAGTAGACAAAGCTCATCTTTAATCAACAGACTTTAGAGTCCAGTCTTTCCAAATCTGTTTTTA ACGACAGAAACTTCTCCCTCCCCTGCCCCATTTTGTCCTCCCCATTAAATGGTACTGTGTCAATAAA ATTCCCAAGCGACCTCTTTAAATCAGCGTTCTTTCCGATGCTGGCTACCACAGTCATGGAAAAGG AGATGTGTTGGACAGGCCTGTCATTACAGGTAGTAGTTGGTGGTACATCCAGTCTGTATTTCTTA CACAAAATTACATCTAAATATTTGACATGAGGCCATTTGCTATCATAAGCCATCACTAGGAACTTC TAGTCTGTCTCACTCGATTGAGGCTACAATGTTGTTAGGTGCTATGACCACAATGAATACAACAG ACAGCCTCTCAGCTGTGCTGCAAAGTATTCATAACCAAAAGACCATATTTCAAATTAAATCATAGT AGCGAATGACATACCATTTACATATTACAATCTGAGCCTCTGAAACAGGGGGAACATATAATGGT ATCCAGAACATCTTTACATCAAAATAACCTATCATACTACAAAGTTTTCACTTCCAAAAAGTGTAAC AGAGTTTAAGGCACTGGTAACTTTGTCCACTGTTAGAGATTAAAACTTCCAAAGCAAATGAAAGA ACCAATGTTCACCTTTAACGTGGGGAAAGTTGGCAAAAAGAACCCCAGGAGGACACCCAAACCTT CTCTGTGTCCTCTGTGGAACCTGGCTTTTTTCTCTTGTCCTCAGAGAAAGAAACAAATGCCGATAT CCTCTGTTTAAAATATGAAAGTACCTTACACCAATAACCCCTAACAGCCTGGGGTCTCAGTGGAAC TAACTTAAGTGAAAGAAAATTAAGACAGGCATAGAATTAGGCCTTTGTTTTGAGGCTTTAGGGG AGCAGAGCTCCATTGTGGCATCTGGAGTTTCACCTGAGGC ____________________________________________________CTACAGGGGTTTCAAATGGTTGCATTTAAGGTCAGAATCTTTGTGTTGGGAAATGCTAGCGACTGAGCCTTGACAGCTGAGCACGGGTTGCCTCATCCCTCTCATGCTGTCTATTTCTTAATCTAACAACTGGGCAATGCGTTAAACTGGCTTTTTTGACTTCCCAGAACAATATCTAATTAGCAAATAACACAATTCAGTGACATTCAGCAGGATGCAAATTCCAGACACTGCAATCATGAACACTGTGAAGACAGTCTTCTCCGTGGGCCGGGACACAAAGCAGTCCACAGTGTTGGGACAAGGCCAGGCGTTGCACTTCACCAGCCGCTGCATGGAGAAGCCGTCGTACATGACATAGAAGACGTACATGAAGGCGGCTTCGAAGATGACCCGGAAGAAGATGCTGCTTGTGTAGGTCCACCACAGGGAGCCTTCGATGCGGACCTTCTGGGTTTTGATCTCCTCGATGTCCTTAAATTCACTCTTTATCTCCCCCTTGATGAACTTCCTCTTCTTCTCATGTCTCCGGTAGGCCACGTGCATGGCCACTAGGAGCGCTGGCGTGGACACGAAGATCAGCTGCAGGGCCCATAGCCGGATGTGGGAGATGGGGAAGTAGTGATCGTAGCACACGTTCTTGCAGCCTGGCTGCAGGGTGTTGCAGACAAAGTCGGCCTGCTCATCTCCCCACACCTCCTTTGCAGCCACAACGAGGATCATAATGCGAAAAATGAAGAGGACGGTGAGCCAGATCTTTCCAATGCTGGTGGAGTGTTTGTTCACACCCCCCAGGATCGTCTGCAGCGTGCCCCAATCCATCTTCTACTCTGGGCGGTTTGCTCTGGAAAAGACGAATGCACACAACACAGGAATCACTAGCTAGGACAGAACAGGGAGACTTCTCTGAGTCTGGGTAAGC

  17. G79A polymorphism C-34T variant 35delG 167delT 35delG and 167delT compound heterozygote of mixed Jewish, Italian and Irish decent. Deletion alters chromatogram alignment, which is corrected with the deletion on the opposite chromosome. Both 35delG and 167delT lead to frameshift mutations. C-34T variant Patient with a C-34T variant and a G79A polymorphism. Is there significance to these changes when they co-occur?

  18. 35delG Patient from consanguineous Dominican family with a G139T homozygous mutation, leading to substitution of Valine for Glutamine at amino acid 47, initiating a premature STOP. Start Codon G139T homozygous 35delG common mutation in Caucasian population, found in two Puerto Rican patients and one of mixed Italian, Irish and Jewish decent. 35delG leads to a frameshift mutation, as seen on this chromatogram.

  19. Schematic of Connexin 26 domains with mutations and polymorphisms included • Mutations, polymorphisms and variants exhibited in our study are circled • Mutations are shown inGreen • Polymorphisms are shown inPurple • Variants of unknown significance are shown inOrange • Also seen in our study were 9 patients with C-34T, in the 5’UTR, not previously described • We noted sequence variations at nucleotide 765, with 65/35 C/T K168R Extracellular Domain Transmembrane Domain V27I R127H K224Q Intracellular Domain http://ent.md.shinshu-u.ac.jp/deafgene%25/nonsyndromic/ohtsuka.gif

  20. HE= Heterozygote

  21. HE = Heterozygote HO= Homozygote

  22. Results • one Dominican patient was homozygous for a mutation in GJB2 (G139T) • GJB2 mutations occur in 1/33 European controls (35delG in 2-4%) • only one Hispanic 35delG carrier in our controls; all other nucleotide changes were polymorphisms or novel variants

  23. Conclusions • GJB2 mutations occur less frequently in our minority population • lower carrier frequencies may account for the lower rate of homozygous individuals in our population • possible synergistic interaction of heterozygous GJB2 mutations and a mutation in another gene such as GJB6

  24. Future studies • Patient recruitment • JMC NICU and nursery • JMC audiology clinic • CHAM Craniofacial Center • Controls • Hope for: • 50 cases/year + 300 controls/year

  25. Future Directions • Cx30 • Adjacent to GJB2 • Mutations are rare • May lead to AD late onset deafness • Deletions • Homozygous → deafness • Heterozygous in trans with GJB2 mutation → deafness

  26. Future Directions • SLC26A4 • Encodes monovalent and divalent anion transporter related proteins (Pendrin) • Involved in fluid homeostasis • Mutations cause Pendred syndrome (AR; defects of thyroid, kidney and inner ear) • Often also see Enlarged Vestibular Aqueduct (EVA) or Mondini dysplasia

  27. Reference List For more information on this topic, see the following publications: Marazita ML, et al., (1993) Genetic epidemiologic studies of early-onset deafness in the U.S. school-age population. Am J Med Genet 46:486-491). Kelsell DP, et al., (1997) Connexin 26 mutations in hereditary non-syndromal sensoineural deafness. Nature 387(6628):80-83. Morton, C (2002) Genetics, genomics and gene discovery in the auditory system. Human Molecular Genetics 11(10):1229-1240. Rabionet R, et al., (2002) Connexin mutations in hearing loss, dermatological and neurological disorders. Trends in Mol Med 8(5):205-212). Pandya, A, et al., (2003) Frequency and distribution of GJB2 (connexin 26) and GJB6 (connexin 30) mutations in a large North American repository of deaf probands. Genet Med 5(4):295-303. Additional information may be found at: http://davinci.crg.es/deafness/

More Related