1 / 15

Bio-Identification of Flake Samples Using DNA Barcoding

Is flake fake ?. Bio-Identification of Flake Samples Using DNA Barcoding By Lina Martinez, Jeremy Tallman, Richard Moloney , Chantall Smith, Joanna Wisniewski , Wathsala Kumari Katherine Te. INTRODUCTION. DNA BARCODING.

gustav
Download Presentation

Bio-Identification of Flake Samples Using DNA Barcoding

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Is flake fake ? Bio-Identification of Flake Samples Using DNA Barcoding By Lina Martinez, Jeremy Tallman, Richard Moloney, ChantallSmith, Joanna Wisniewski , Wathsala Kumari Katherine Te

  2. INTRODUCTION DNA BARCODING • Provides a faster method of accuracy determining a species when compared with morphological identification. • It allows for how species are assembled within a biological systems . • Determine the composition/purity of biological samples . • The DNA Barcode used here is a section of the Cytochrome c oxidase 1, a region involved in the electron phase of mitochondrial respiration.

  3. AIMS • Our group decided to determine if DNA Barcoding could be used to identify which species of shark are sold in Australia as “flake”. • Hypothesis – that different species of shark are sold under the banner of flake

  4. MATERIALS AND METHODS Primer sequences used in the experiment were: • “A fragment from the 5’ end of COI (~ 648 base pairs) is isolated (the entire gene has~ 1500 base pairs).” • COI barcoding (fish) 5’-TGTAAAACGACGGCCAGTCAACCAACCACAAAGACATTGGCAC -3’ • FORWARD PRIMER – VF2_t1 5’-TGTAAAACGACGGCCAGTCGACTAATCATAAAGATATCGGCAC-3’ • FORWARD PRIMER – Fish F2_t1 5’-CAGGAAACAGCTATGACACTTCAGGGTGACCGAAGAATCAGAA-3’ • REVERSE PRIMER – Fish R2_t1 5’-CAGGAAACAGCTATGACACCTCAGGGTGTCCGAARAAYCARAA-3’ • REVERSE PRIMER – FR1 • For other materials and methods refer to Project Manual (Diploma In Laboratory Techniques MSL50109)

  5. RESULTS FROM OUR (PCR) • We had DNA of of about 580 base pairs which was the expected size.

  6. RESULTS AFTER PCR • CONSENSUS SEQUENCES • FLAKE SAMPLE - Galeorhinusgaleus • TGGGACAGCCAGGATCTCTTTTAGGAGATGACCAGATTTATAATGTGATCGTAACCGCCCATGCTTTTGTAATAATCTTTTTTATGGTTATACCAATCATGATTGGTGGCTTTGGAAATTGACTAGTTCCATTAATAATTGGTGCGCCTGATATAGCCTTCCCACGGATAAATAACATAAGCTTCTGACTTCTTCCACCATCATTCCTTCTTCTCCTAGCTTCTGCCGGAGTAGAAGCTGGAGCAGGTACTGGTTGAACAGTATATCCTCCACTAGCAAGCAATTTAGCCCATGCTGGACCATCTGTAGATTTAGCCATTTTCTCCCTTCATTTAGCCGGTATCTCATCAATCCTAGCCTCAATTAATTTTATTACAACCATTATTAACATAAAACCCCCAGCTATTTCCCAATATCAAACACCATTATTTGTTTGATCAATTCTTGTAACTACTATTCTTCTTCTCCTCTCTCTCCCAGTTCTCGCAGCAGGAATCACAATATTACTTACAGACCGTAACCTTAATACCACATTCTTTGACCCTGCAGGTGGAGGAGACCCAATCCTTTACCAACATTTATTCTGATTCTTC

  7. …Results Table 1. Results of DNA sequencing

  8. DISCUSSION

  9. …Discussion GUMMY SHARK http://www.oceanwideimages.com/images/10801/large/gummy-shark-24M2642-01D.jpg

  10. …Discussion – the species found SPOTTED ESTUARY SMOOTH-HOUND http://www.southern-edge.com/rig-shark-or-lemonfish/

  11. …Discussion SCHOOL SHARK, TOPE SHARK, SOUPFIN SHARKORSNAPPER SHARK,  http://www.exploreuw.com/Galeorhinus_galeus.d

  12. …Discussion • Our results support our hypothesis. We found 3 different speciesare sold as “flake”. This shows that DNA Barcoding can be used to identify seafood species sold in Australia. • 2 out of the 5 shark DNA sequences was that of the endangered Tope Shark. • The Tope Shark is found on the Red List of the IUCN - The World Conservation Union. • DNA barcoding can be used to help in the conservation of endangered species.

  13. The government has a National Plan of Action for the Conservation and Management of Sharks 2012 – Shark Plan 2 • It aims on working on conservation and managing Australian Fisheries. • Our data suggests that DNA barcoding could be a good method to assist this plan

  14. ….Discussion • For future experiments a bigger sample size would help to discover how wide spread endangered species are being consumed and labelled as “shark”. • The larger the sample size of shark being tested, the more we can have confirmation of our results. • Our results agree with the results of the students from New York’s Trinity School who did an experiment on ‘mislabelled’ fish.

  15. CONCLUSION

More Related