1 / 44

Advancements in Genomics: Current Progress and Future Directions

Explore the latest developments in genomics, from gene mapping to identifying functional elements in the human genome. Learn about the Human Genome Project's achievements and the future of genomics in biology and medicine.

henriettar
Download Presentation

Advancements in Genomics: Current Progress and Future Directions

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Genomics, Medicine,and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D.

  2. A SMALL SAMPLING OF COOL THINGS ABOUT THE GENOME • Humans have fewer protein-coding genes than expected – less than 30,000 • Only about 5% of human DNA seems to be under strong selective pressure – but 2/3 of this is of unknown function • Male mutation rate is twice that of females

  3. All of the original goals of the Human Genome Project have been accomplished What’s next?

  4. Genomics to Biology • Define the structure of human variation: the human haplotype map • Sequence lots of additional genomes • Develop new technologies for sequencing, genotyping, expression analysis, proteomics, and molecular imaging • Identify all functional elements of the genome • Identify all the proteins of the cell, and their interactions • Develop a computational model of the cell

  5. Genomics to Biology • Define the structure of human variation: the human haplotype map • Sequence lots of additional genomes • Develop new technologies for sequencing, genotyping, expression analysis, proteomics, and molecular imaging • Identify all functional elements of the genome • Identify all the proteins of the cell, and their interactions • Develop a computational model of the cell

  6. Finding genes for Mendelian phenotypes has made tremendous progress over the last 10 years Finding genes for complex (polygenic) disorders and traits has moved much more slowly

  7. Sequence from chromosome 7 GAAATAATTAATGTTTTCCTTCCTTCTCCTATTTTGTCCTTTACTTCAATTTATTTATTTATTATTAATATTATTATTTTTTGAGACGGAGTTTCACTCTTGTTGCCAACCTGGAGTGCAGTGGCGTGATCTCAGCTCACTGCACACTCCGCTTTCC/TGGTTTCAAGCGATTCTCCTGCCTCAGCCTCCTGAGTAGCTGGGACTACAGTCACACACCACCACGCCCGGCTAATTTTTGTATTTTTAGTAGAGTTGGGGTTTCACCATGTTGGCCAGACTGGTCTCGAACTCCTGACCTTGTGATCCGCCAGCCTCTGCCTCCCAAAGAGCTGGGATTACAGGCGTGAGCCACCGCGCTCGGCCCTTTGCATCAATTTCTACAGCTTGTTTTCTTTGCCTGGACTTTACAAGTCTTACCTTGTTCTGCCTTCAGATATTTGTGTGGTCTCATTCTGGTGTGCCAGTAGCTAAAAATCCATGATTTGCTCTCATCCCACTCCTGTTGTTCATCTCCTCTTATCTGGGGTCACA/CTATCTCTTCGTGATTGCATTCTGATCCCCAGTACTTAGCATGTGCGTAACAACTCTGCCTCTGCTTTCCCAGGCTGTTGATGGGGTGCTGTTCATGCCTCAGAAAAATGCATTGTAAGTTAAATTATTAAAGATTTTAAATATAGGAAAAAAGTAAGCAAACATAAGGAACAAAAAGGAAAGAACATGTATTCTAATCCATTATTTATTATACAATTAAGAAATTTGGAAACTTTAGATTACACTGCTTTTAGAGATGGAGATGTAGTAAGTCTTTTACTCTTTACAAAATACATGTGTTAGCAATTTTGGGAAGAATAGTAACTCACCCGAACAGTGTAATGTGAATATGTCACTTACTAGAGGAAAGAAGGCACTTGAAAAACATCTCTAAACCGTATAAAAACAATTACATCATAATGATGAAAACCCAAGGAATTTTTTTAGAAAACATTACCAGGGCTAATAACAAAGTAGAGCCACATGTCATTTATCTTCCCTTTGTGTCTGTGTGAGAATTCTAGAGTTATATTTGTACATAGCATGGAAAAATGAGAGGCTAGTTTATCAACTAGTTCATTTTTAAAAGTCTAACACATCCTAGGTATAGGTGAACTGTCCTCCTGCCAATGTATTGCACATTTGTGCCCAGATCCAGCATAGGGTATGTTTGCCATTTACAAACGTTTATGTCTTAAGAGAGGAAATATGAAGAGCAAAACAGTGCATGCTGGAGAGAGAAAGCTGATACAAATATAAATGAAACAATAATTGGAAAAATTGAGAAACTACTCATTTTCTAAATTACTCATGTATTTTCCTAGAATTTAAGTCTTTTAATTTTTGATAAATCCCAATGTGAGACAAGATAAGTATTAGTGATGGTATGAGTAATTAATATCTGTTATATAATATTCATTTTCATAGTGGAAGAAATAAAATAAAGGTTGTGATGATTGTTGATTATTTTTTCTAGAGGGGTTGTCAGGGAAAGAAATTGCTTTTTTTCATTCTCTCTTTCCACTAAGAAAGTTCAACTATTAATTTAGGCACATACAATAATTACTCCATTCTAAAATGCCAAAAAGGTAATTTAAGAGACTTAAAACTGAAAAGTTTAAGATAGTCACACTGAACTATATTAAAAAATCCACAGGGTGGTTGGAACTAGGCCTTATATTAAAGAGGCTAAAAATTGCAATAAGACCACAGGCTTTAAATATGGCTTTAAACTGTGAAAGGTGAAACTAGAATGAATAAAATCCTATAAATTTAAATCAAAAGAAAGAAACAAACTA/GAAATTAAAGTTAATATACAAGAATATGGTGGCCTGGATCTAGTGAACATATAGTAAAGATAAAACAGAATATTTCTGAAAAATCCTGGAAAATCTTTTGGGCTAACCTGAAAACAGTATATTTGAAACTATTTTTAAA Three SNPs are present

  8. Whole Genome Association Approach to Common Disease and Pharmacogenomics • Identify all 10 million common SNPs • Collect 1000 cases and 1000 controls • Genotype all DNAs for all SNPs

  9. 2000 DNAs x 10,000,000 SNPs = 20,000,000,000 genotypes

  10. Sequence from chromosome 7 GAAATAATTAATGTTTTCCTTCCTTCTCCTATTTTGTCCTTTACTTCAATTTATTTATTTATTATTAATATTATTATTTTTTGAGACGGAGTTTCACTCTTGTTGCCAACCTGGAGTGCAGTGGCGTGATCTCAGCTCACTGCACACTCCGCTTTCC/TGGTTTCAAGCGATTCTCCTGCCTCAGCCTCCTGAGTAGCTGGGACTACAGTCACACACCACCACGCCCGGCTAATTTTTGTATTTTTAGTAGAGTTGGGGTTTCACCATGTTGGCCAGACTGGTCTCGAACTCCTGACCTTGTGATCCGCCAGCCTCTGCCTCCCAAAGAGCTGGGATTACAGGCGTGAGCCACCGCGCTCGGCCCTTTGCATCAATTTCTACAGCTTGTTTTCTTTGCCTGGACTTTACAAGTCTTACCTTGTTCTGCCTTCAGATATTTGTGTGGTCTCATTCTGGTGTGCCAGTAGCTAAAAATCCATGATTTGCTCTCATCCCACTCCTGTTGTTCATCTCCTCTTATCTGGGGTCACA/CTATCTCTTCGTGATTGCATTCTGATCCCCAGTACTTAGCATGTGCGTAACAACTCTGCCTCTGCTTTCCCAGGCTGTTGATGGGGTGCTGTTCATGCCTCAGAAAAATGCATTGTAAGTTAAATTATTAAAGATTTTAAATATAGGAAAAAAGTAAGCAAACATAAGGAACAAAAAGGAAAGAACATGTATTCTAATCCATTATTTATTATACAATTAAGAAATTTGGAAACTTTAGATTACACTGCTTTTAGAGATGGAGATGTAGTAAGTCTTTTACTCTTTACAAAATACATGTGTTAGCAATTTTGGGAAGAATAGTAACTCACCCGAACAGTGTAATGTGAATATGTCACTTACTAGAGGAAAGAAGGCACTTGAAAAACATCTCTAAACCGTATAAAAACAATTACATCATAATGATGAAAACCCAAGGAATTTTTTTAGAAAACATTACCAGGGCTAATAACAAAGTAGAGCCACATGTCATTTATCTTCCCTTTGTGTCTGTGTGAGAATTCTAGAGTTATATTTGTACATAGCATGGAAAAATGAGAGGCTAGTTTATCAACTAGTTCATTTTTAAAAGTCTAACACATCCTAGGTATAGGTGAACTGTCCTCCTGCCAATGTATTGCACATTTGTGCCCAGATCCAGCATAGGGTATGTTTGCCATTTACAAACGTTTATGTCTTAAGAGAGGAAATATGAAGAGCAAAACAGTGCATGCTGGAGAGAGAAAGCTGATACAAATATAAATGAAACAATAATTGGAAAAATTGAGAAACTACTCATTTTCTAAATTACTCATGTATTTTCCTAGAATTTAAGTCTTTTAATTTTTGATAAATCCCAATGTGAGACAAGATAAGTATTAGTGATGGTATGAGTAATTAATATCTGTTATATAATATTCATTTTCATAGTGGAAGAAATAAAATAAAGGTTGTGATGATTGTTGATTATTTTTTCTAGAGGGGTTGTCAGGGAAAGAAATTGCTTTTTTTCATTCTCTCTTTCCACTAAGAAAGTTCAACTATTAATTTAGGCACATACAATAATTACTCCATTCTAAAATGCCAAAAAGGTAATTTAAGAGACTTAAAACTGAAAAGTTTAAGATAGTCACACTGAACTATATTAAAAAATCCACAGGGTGGTTGGAACTAGGCCTTATATTAAAGAGGCTAAAAATTGCAATAAGACCACAGGCTTTAAATATGGCTTTAAACTGTGAAAGGTGAAACTAGAATGAATAAAATCCTATAAATTTAAATCAAAAGAAAGAAACAAACTA/GAAATTAAAGTTAATATACAAGAATATGGTGGCCTGGATCTAGTGAACATATAGTAAAGATAAAACAGAATATTTCTGAAAAATCCTGGAAAATCTTTTGGGCTAACCTGAAAACAGTATATTTGAAACTATTTTTAAA Are the SNPs correlated with their neighbors?

  11. These three SNPs could theoretically occur in 8 different haplotypes …C…A…A… …C…A…G… …C…C…A… …C…C…G… …T…A…A… …T…A…G… …T…C…A… …T…C…G…

  12. But in practice, only two are observed …C…A…A… …C…A…G… …C…C…A… …C…C…G… …T…A…A… …T…A…G… …T…C…A… …T…C…G…

  13. ~ 20,000 bp

  14. A Haplotype Map of Human Variation • Goal is to define all common haplotypes in the human genome • Genome-wide association studies can then be done with 30 – 50 times less work • Project is international (9 labs in 5 countries); was initiated in October 2002, using samples of African, Asian, and European origin

  15. Genomics to Health • Identify the genetic and environmental risk factors for all common disease • Develop “sentinel systems” for early detection of disease and molecular taxonomy of illness • Develop and deploy high-throughput robotic screening of small molecules for academic researchers • Catalyze development of large human cohorts for genotype-phenotype correlations • Elucidate the role that genomics can play in reducing health disparities • Utilize genomics to improve health in the developing world

  16. Genomics to Society • Enhance genetic privacy and protection against genetic discrimination • Encourage appropriate patenting and licensing practices to benefit the public • Understand the relationship of genomics, race, and ethnicity, and bring this to bear usefully on the often contentious dialog about race • Assess the ramifications of advances in understanding genetic factors that influence behavior • Define boundaries of the appropriate application of genomics in the non-medical arena

  17. What will be the impact of genomics on the practice of medicine?

  18. I think there is a world market for maybe five computers. -- Thomas Watson Chairman of IBM, 1943

  19. The concept is interesting and well-formed, but in order to earn better than a ‘C’, the idea must be feasible. -- Yale Professor evaluating Fred Smith’s student paper proposing the FedEx company

  20. We don’t like their sound, and guitar music is on the way out. -- Decca Records, rejecting the Beatles, 1962

  21. 640K ought to be enough for anybody. -- Bill Gates, 1981

  22. Most of the major contributing genes for diabetes, heart disease, cancer, mental illness, Alzheimer’s and Parkinson’s disease, asthma, etc. will be identified within the next 5 – 10 years.

  23. Pharmacogenomics: Unlocking the Human Genome for Better Drug Therapy All patients with same diagnosis Remove Toxic response No response Treat Responses without toxic side effects McLeod & Evans, Ann Rev Pharmacol Toxicol 41:101-21, 2001

  24. Gleevec™ – Specifically Targets • An Abnormal Protein, Blocking • Its Ability To Cause Chronic Myeloid Leukemia Chromosome 9;22 translocation Bcr-Ablfusion protein Bcr-Ablfusion protein Gleevec™ Normal CML

  25. 2010 Mainstreaming of individualized preventive medicine -- Predictive genetic tests available for a dozen conditions -- Interventions to reduce risk available for several of these -- Pharmacogenomics is standard of care for several drugs BUT…. -- Will access be inequitable? Will health disparities persist? -- Will reasonably effective legislative solutions to genetic discrimination be in place?

  26. 2020 Genomic therapeutic revolution in full swing -- Gene-based designer drugs available for diabetes, Alzheimer’s… -- Gene therapy standard of care for several conditions BUT…. -- Intense debate underway on non-medical uses of genetics

  27. www.genome.gov

More Related